\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0426471750:

Variant ID: vg0426471750 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 26471750
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTTAAAGTCTATATAGAAATATCATTTATAAATAACTAAAAGTTAAAATAAAAAAGAAAGAAAGATTGGAAGAAGAGTCTATATTTCATATAGAAATA[C/T]
AATTTAGAAAATAGCTAGAATTAAGAACTACTCCCTCCGTTTCAGGTTATAAGACGTTTTGACTTTAGTAAAAGTCAATCTGTTTTAAGTTTAACTAAGT

Reverse complement sequence

ACTTAGTTAAACTTAAAACAGATTGACTTTTACTAAAGTCAAAACGTCTTATAACCTGAAACGGAGGGAGTAGTTCTTAATTCTAGCTATTTTCTAAATT[G/A]
TATTTCTATATGAAATATAGACTCTTCTTCCAATCTTTCTTTCTTTTTTATTTTAACTTTTAGTTATTTATAAATGATATTTCTATATAGACTTTAAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 5.60% 3.24% 0.28% NA
All Indica  2759 97.50% 0.30% 1.81% 0.33% NA
All Japonica  1512 77.20% 16.70% 5.75% 0.26% NA
Aus  269 97.00% 0.00% 2.97% 0.00% NA
Indica I  595 96.00% 1.00% 3.03% 0.00% NA
Indica II  465 94.60% 0.20% 3.66% 1.51% NA
Indica III  913 99.20% 0.00% 0.55% 0.22% NA
Indica Intermediate  786 98.50% 0.30% 1.27% 0.00% NA
Temperate Japonica  767 91.70% 3.80% 4.43% 0.13% NA
Tropical Japonica  504 56.20% 36.70% 6.55% 0.60% NA
Japonica Intermediate  241 75.50% 16.20% 8.30% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 3.12% 0.00% NA
Intermediate  90 91.10% 3.30% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0426471750 C -> DEL N N silent_mutation Average:18.806; most accessible tissue: Callus, score: 35.468 N N N N
vg0426471750 C -> T LOC_Os04g44690.1 upstream_gene_variant ; 3688.0bp to feature; MODIFIER silent_mutation Average:18.806; most accessible tissue: Callus, score: 35.468 N N N N
vg0426471750 C -> T LOC_Os04g44700.1 upstream_gene_variant ; 3508.0bp to feature; MODIFIER silent_mutation Average:18.806; most accessible tissue: Callus, score: 35.468 N N N N
vg0426471750 C -> T LOC_Os04g44700.2 upstream_gene_variant ; 3508.0bp to feature; MODIFIER silent_mutation Average:18.806; most accessible tissue: Callus, score: 35.468 N N N N
vg0426471750 C -> T LOC_Os04g44690-LOC_Os04g44700 intergenic_region ; MODIFIER silent_mutation Average:18.806; most accessible tissue: Callus, score: 35.468 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0426471750 3.12E-07 NA mr1076 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426471750 6.88E-07 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426471750 9.69E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251