\
| Variant ID: vg0426471750 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 26471750 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTTTAAAGTCTATATAGAAATATCATTTATAAATAACTAAAAGTTAAAATAAAAAAGAAAGAAAGATTGGAAGAAGAGTCTATATTTCATATAGAAATA[C/T]
AATTTAGAAAATAGCTAGAATTAAGAACTACTCCCTCCGTTTCAGGTTATAAGACGTTTTGACTTTAGTAAAAGTCAATCTGTTTTAAGTTTAACTAAGT
ACTTAGTTAAACTTAAAACAGATTGACTTTTACTAAAGTCAAAACGTCTTATAACCTGAAACGGAGGGAGTAGTTCTTAATTCTAGCTATTTTCTAAATT[G/A]
TATTTCTATATGAAATATAGACTCTTCTTCCAATCTTTCTTTCTTTTTTATTTTAACTTTTAGTTATTTATAAATGATATTTCTATATAGACTTTAAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.90% | 5.60% | 3.24% | 0.28% | NA |
| All Indica | 2759 | 97.50% | 0.30% | 1.81% | 0.33% | NA |
| All Japonica | 1512 | 77.20% | 16.70% | 5.75% | 0.26% | NA |
| Aus | 269 | 97.00% | 0.00% | 2.97% | 0.00% | NA |
| Indica I | 595 | 96.00% | 1.00% | 3.03% | 0.00% | NA |
| Indica II | 465 | 94.60% | 0.20% | 3.66% | 1.51% | NA |
| Indica III | 913 | 99.20% | 0.00% | 0.55% | 0.22% | NA |
| Indica Intermediate | 786 | 98.50% | 0.30% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 91.70% | 3.80% | 4.43% | 0.13% | NA |
| Tropical Japonica | 504 | 56.20% | 36.70% | 6.55% | 0.60% | NA |
| Japonica Intermediate | 241 | 75.50% | 16.20% | 8.30% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 3.30% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0426471750 | C -> DEL | N | N | silent_mutation | Average:18.806; most accessible tissue: Callus, score: 35.468 | N | N | N | N |
| vg0426471750 | C -> T | LOC_Os04g44690.1 | upstream_gene_variant ; 3688.0bp to feature; MODIFIER | silent_mutation | Average:18.806; most accessible tissue: Callus, score: 35.468 | N | N | N | N |
| vg0426471750 | C -> T | LOC_Os04g44700.1 | upstream_gene_variant ; 3508.0bp to feature; MODIFIER | silent_mutation | Average:18.806; most accessible tissue: Callus, score: 35.468 | N | N | N | N |
| vg0426471750 | C -> T | LOC_Os04g44700.2 | upstream_gene_variant ; 3508.0bp to feature; MODIFIER | silent_mutation | Average:18.806; most accessible tissue: Callus, score: 35.468 | N | N | N | N |
| vg0426471750 | C -> T | LOC_Os04g44690-LOC_Os04g44700 | intergenic_region ; MODIFIER | silent_mutation | Average:18.806; most accessible tissue: Callus, score: 35.468 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0426471750 | 3.12E-07 | NA | mr1076 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426471750 | 6.88E-07 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0426471750 | 9.69E-06 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |