\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0426455143:

Variant ID: vg0426455143 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 26455143
Reference Allele: CAlternative Allele: T,CGT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CAGTGAACAGATTGTCGGCTCCCGGAGGACCATGGCCAGCCACAGCGATCACATACTCCCTCCACAAAAATTAAAAAAAAAACTTGTTTTCTGTATCTAA[C/T,CGT]
GTTTTGACCGTTCGTCTTATTTAAAAAAATTATTAAAAAAATTAAAAAGACAAGTCACGTATAAAATATTAATCATGTTTTATCATCTAACAATAATAAA

Reverse complement sequence

TTTATTATTGTTAGATGATAAAACATGATTAATATTTTATACGTGACTTGTCTTTTTAATTTTTTTAATAATTTTTTTAAATAAGACGAACGGTCAAAAC[G/A,ACG]
TTAGATACAGAAAACAAGTTTTTTTTTTAATTTTTGTGGAGGGAGTATGTGATCGCTGTGGCTGGCCATGGTCCTCCGGGAGCCGACAATCTGTTCACTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.50% 9.50% 0.91% 0.00% CGT: 0.02%
All Indica  2759 82.50% 16.00% 1.49% 0.00% NA
All Japonica  1512 99.70% 0.10% 0.13% 0.00% CGT: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 1.00% 0.34% 0.00% NA
Indica II  465 35.50% 59.10% 5.38% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 78.90% 19.30% 1.78% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.00% CGT: 0.13%
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0426455143 C -> CGT LOC_Os04g44670-LOC_Os04g44690 intergenic_region ; MODIFIER silent_mutation Average:90.67; most accessible tissue: Minghui63 panicle, score: 96.734 N N N N
vg0426455143 C -> T LOC_Os04g44670-LOC_Os04g44690 intergenic_region ; MODIFIER silent_mutation Average:90.67; most accessible tissue: Minghui63 panicle, score: 96.734 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0426455143 C CGT 0.03 -0.22 -0.2 -0.1 -0.13 -0.22
vg0426455143 C T -0.03 0.0 -0.01 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0426455143 NA 2.12E-16 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0426455143 NA 1.23E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 4.45E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 3.16E-11 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 8.75E-07 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 2.73E-14 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 4.47E-09 mr1169 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 8.11E-10 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 5.24E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 1.78E-08 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 6.51E-07 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 1.60E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 2.93E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 1.42E-08 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 5.56E-07 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 9.17E-06 mr1731 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 2.59E-06 mr1733 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 6.63E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 2.31E-06 mr1965 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 5.55E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 3.38E-09 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 9.52E-10 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 9.15E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 2.65E-08 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 3.73E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 4.84E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 7.20E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 2.85E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 1.44E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 1.66E-07 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 4.18E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 3.56E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 2.34E-06 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0426455143 NA 1.12E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251