Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0425861893:

Variant ID: vg0425861893 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 25861893
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGGCTCCCATTGTTTGGCTTATTCACAGAATAAGCAAAACGGCATATTTGCAAACGAAAAATAATTTGTAAATAAAACTTTTATATACGTGCTCTTAA[T/C]
GATCTAAAAGCAAAGGTTGAAAAATAAACTTCGATGAAAAAACCTTAAAATCAACTTCAAATTTAAGGTTGAAAATTCAAATTTTGGCTGATAAGCATAA

Reverse complement sequence

TTATGCTTATCAGCCAAAATTTGAATTTTCAACCTTAAATTTGAAGTTGATTTTAAGGTTTTTTCATCGAAGTTTATTTTTCAACCTTTGCTTTTAGATC[A/G]
TTAAGAGCACGTATATAAAAGTTTTATTTACAAATTATTTTTCGTTTGCAAATATGCCGTTTTGCTTATTCTGTGAATAAGCCAAACAATGGGAGCCTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.50%	28.60%	5.97%	0.00%	NA
All Indica	2759	85.20%	7.90%	6.92%	0.00%	NA
All Japonica	1512	23.40%	71.80%	4.83%	0.00%	NA
Aus	269	92.20%	4.10%	3.72%	0.00%	NA
Indica I	595	64.90%	18.80%	16.30%	0.00%	NA
Indica II	465	86.20%	7.10%	6.67%	0.00%	NA
Indica III	913	98.60%	0.90%	0.55%	0.00%	NA
Indica Intermediate	786	84.50%	8.10%	7.38%	0.00%	NA
Temperate Japonica	767	15.10%	79.90%	4.95%	0.00%	NA
Tropical Japonica	504	22.60%	74.40%	2.98%	0.00%	NA
Japonica Intermediate	241	51.50%	40.20%	8.30%	0.00%	NA
VI/Aromatic	96	89.60%	8.30%	2.08%	0.00%	NA
Intermediate	90	61.10%	32.20%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0425861893	T -> C	LOC_Os04g43690.1	upstream_gene_variant ; 1860.0bp to feature; MODIFIER	silent_mutation	Average:51.361; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg0425861893	T -> C	LOC_Os04g43690.2	upstream_gene_variant ; 1862.0bp to feature; MODIFIER	silent_mutation	Average:51.361; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N
vg0425861893	T -> C	LOC_Os04g43700.1	intron_variant ; MODIFIER	silent_mutation	Average:51.361; most accessible tissue: Minghui63 flag leaf, score: 63.692	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0425861893	NA	3.02E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425861893	2.50E-06	NA	mr1164	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425861893	NA	1.75E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425861893	4.13E-06	NA	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425861893	NA	3.76E-09	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425861893	NA	3.71E-09	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425861893	NA	1.44E-06	mr1576_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425861893	NA	7.65E-06	mr1996_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251