\
| Variant ID: vg0425698075 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 25698075 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, G: 0.11, others allele: 0.00, population size: 186. )
ATAGTGTGAGCTTCCTCATTGATCTTGATTGATTGTGTGCATATGCATTACTTCATATCCATATATATGCACATCTTGAGGGGGAGCTTATTCTATATTT[G/T]
GTTCATTATAAGATCTCTACCTTGATTTGAAATTATCTTTCATCTCATCTCTTTGTATTGTTTATATCGGATTATTATCTATCACAAAAGAGAGAAAAGA
TCTTTTCTCTCTTTTGTGATAGATAATAATCCGATATAAACAATACAAAGAGATGAGATGAAAGATAATTTCAAATCAAGGTAGAGATCTTATAATGAAC[C/A]
AAATATAGAATAAGCTCCCCCTCAAGATGTGCATATATATGGATATGAAGTAATGCATATGCACACAATCAATCAAGATCAATGAGGAAGCTCACACTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 50.90% | 49.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 78.50% | 21.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0425698075 | G -> T | LOC_Os04g43410.1 | upstream_gene_variant ; 4157.0bp to feature; MODIFIER | silent_mutation | Average:26.662; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| vg0425698075 | G -> T | LOC_Os04g43420.1 | upstream_gene_variant ; 2786.0bp to feature; MODIFIER | silent_mutation | Average:26.662; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| vg0425698075 | G -> T | LOC_Os04g43430.1 | downstream_gene_variant ; 3999.0bp to feature; MODIFIER | silent_mutation | Average:26.662; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| vg0425698075 | G -> T | LOC_Os04g43430.2 | downstream_gene_variant ; 3999.0bp to feature; MODIFIER | silent_mutation | Average:26.662; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| vg0425698075 | G -> T | LOC_Os04g43410-LOC_Os04g43420 | intergenic_region ; MODIFIER | silent_mutation | Average:26.662; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0425698075 | NA | 2.83E-06 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425698075 | 4.24E-06 | NA | mr1580_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |