\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0425648422:

Variant ID: vg0425648422 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 25648422
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATATTAGAAGAGTGGACTAGAGTCCATATAGAAATACAATTAGAAAATAACTTAAATTCGGAATTAAAAATAAGGAATATTAGAAGTAGATTATAGAGT[C/A]
CATATATAAATACAAATAGGAAATAACTGAAATTCGGAATTAAAATAAGGAATATTAGAAATAGAGTATAGAGTCCATATAGAAATACTATTTAGAAATA

Reverse complement sequence

TATTTCTAAATAGTATTTCTATATGGACTCTATACTCTATTTCTAATATTCCTTATTTTAATTCCGAATTTCAGTTATTTCCTATTTGTATTTATATATG[G/T]
ACTCTATAATCTACTTCTAATATTCCTTATTTTTAATTCCGAATTTAAGTTATTTTCTAATTGTATTTCTATATGGACTCTAGTCCACTCTTCTAATATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 9.90% 1.59% 0.00% NA
All Indica  2759 98.40% 0.80% 0.80% 0.00% NA
All Japonica  1512 68.10% 28.70% 3.24% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 0.00% 2.18% 0.00% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 99.30% 0.50% 0.11% 0.00% NA
Indica Intermediate  786 97.80% 1.30% 0.89% 0.00% NA
Temperate Japonica  767 94.40% 3.50% 2.09% 0.00% NA
Tropical Japonica  504 24.20% 71.40% 4.37% 0.00% NA
Japonica Intermediate  241 75.90% 19.50% 4.56% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 12.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0425648422 C -> A LOC_Os04g43360.1 upstream_gene_variant ; 3815.0bp to feature; MODIFIER silent_mutation Average:25.672; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0425648422 C -> A LOC_Os04g43370.1 upstream_gene_variant ; 1746.0bp to feature; MODIFIER silent_mutation Average:25.672; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0425648422 C -> A LOC_Os04g43360.2 upstream_gene_variant ; 3815.0bp to feature; MODIFIER silent_mutation Average:25.672; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0425648422 C -> A LOC_Os04g43380.1 downstream_gene_variant ; 1710.0bp to feature; MODIFIER silent_mutation Average:25.672; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0425648422 C -> A LOC_Os04g43370-LOC_Os04g43380 intergenic_region ; MODIFIER silent_mutation Average:25.672; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0425648422 7.94E-06 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422 NA 2.78E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422 8.67E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422 NA 2.89E-29 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422 NA 3.42E-20 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422 NA 1.45E-06 mr1858 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422 NA 1.45E-06 mr1859 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422 NA 5.70E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422 NA 1.77E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422 NA 9.29E-17 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422 NA 2.33E-10 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422 NA 2.65E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422 NA 3.44E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422 NA 1.17E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251