\
| Variant ID: vg0425648422 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 25648422 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATATTAGAAGAGTGGACTAGAGTCCATATAGAAATACAATTAGAAAATAACTTAAATTCGGAATTAAAAATAAGGAATATTAGAAGTAGATTATAGAGT[C/A]
CATATATAAATACAAATAGGAAATAACTGAAATTCGGAATTAAAATAAGGAATATTAGAAATAGAGTATAGAGTCCATATAGAAATACTATTTAGAAATA
TATTTCTAAATAGTATTTCTATATGGACTCTATACTCTATTTCTAATATTCCTTATTTTAATTCCGAATTTCAGTTATTTCCTATTTGTATTTATATATG[G/T]
ACTCTATAATCTACTTCTAATATTCCTTATTTTTAATTCCGAATTTAAGTTATTTTCTAATTGTATTTCTATATGGACTCTAGTCCACTCTTCTAATATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.60% | 9.90% | 1.59% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 0.80% | 0.80% | 0.00% | NA |
| All Japonica | 1512 | 68.10% | 28.70% | 3.24% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 0.00% | 2.18% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 1.30% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 94.40% | 3.50% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 24.20% | 71.40% | 4.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.90% | 19.50% | 4.56% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 12.20% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0425648422 | C -> A | LOC_Os04g43360.1 | upstream_gene_variant ; 3815.0bp to feature; MODIFIER | silent_mutation | Average:25.672; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0425648422 | C -> A | LOC_Os04g43370.1 | upstream_gene_variant ; 1746.0bp to feature; MODIFIER | silent_mutation | Average:25.672; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0425648422 | C -> A | LOC_Os04g43360.2 | upstream_gene_variant ; 3815.0bp to feature; MODIFIER | silent_mutation | Average:25.672; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0425648422 | C -> A | LOC_Os04g43380.1 | downstream_gene_variant ; 1710.0bp to feature; MODIFIER | silent_mutation | Average:25.672; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0425648422 | C -> A | LOC_Os04g43370-LOC_Os04g43380 | intergenic_region ; MODIFIER | silent_mutation | Average:25.672; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0425648422 | 7.94E-06 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425648422 | NA | 2.78E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425648422 | 8.67E-06 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425648422 | NA | 2.89E-29 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425648422 | NA | 3.42E-20 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425648422 | NA | 1.45E-06 | mr1858 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425648422 | NA | 1.45E-06 | mr1859 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425648422 | NA | 5.70E-07 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425648422 | NA | 1.77E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425648422 | NA | 9.29E-17 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425648422 | NA | 2.33E-10 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425648422 | NA | 2.65E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425648422 | NA | 3.44E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425648422 | NA | 1.17E-13 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |