Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0425648422:

Variant ID: vg0425648422 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 25648422
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATATTAGAAGAGTGGACTAGAGTCCATATAGAAATACAATTAGAAAATAACTTAAATTCGGAATTAAAAATAAGGAATATTAGAAGTAGATTATAGAGT[C/A]
CATATATAAATACAAATAGGAAATAACTGAAATTCGGAATTAAAATAAGGAATATTAGAAATAGAGTATAGAGTCCATATAGAAATACTATTTAGAAATA

Reverse complement sequence

TATTTCTAAATAGTATTTCTATATGGACTCTATACTCTATTTCTAATATTCCTTATTTTAATTCCGAATTTCAGTTATTTCCTATTTGTATTTATATATG[G/T]
ACTCTATAATCTACTTCTAATATTCCTTATTTTTAATTCCGAATTTAAGTTATTTTCTAATTGTATTTCTATATGGACTCTAGTCCACTCTTCTAATATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.60%	9.90%	1.59%	0.00%	NA
All Indica	2759	98.40%	0.80%	0.80%	0.00%	NA
All Japonica	1512	68.10%	28.70%	3.24%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.80%	0.00%	2.18%	0.00%	NA
Indica II	465	98.50%	1.30%	0.22%	0.00%	NA
Indica III	913	99.30%	0.50%	0.11%	0.00%	NA
Indica Intermediate	786	97.80%	1.30%	0.89%	0.00%	NA
Temperate Japonica	767	94.40%	3.50%	2.09%	0.00%	NA
Tropical Japonica	504	24.20%	71.40%	4.37%	0.00%	NA
Japonica Intermediate	241	75.90%	19.50%	4.56%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	12.20%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0425648422	C -> A	LOC_Os04g43360.1	upstream_gene_variant ; 3815.0bp to feature; MODIFIER	silent_mutation	Average:25.672; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0425648422	C -> A	LOC_Os04g43370.1	upstream_gene_variant ; 1746.0bp to feature; MODIFIER	silent_mutation	Average:25.672; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0425648422	C -> A	LOC_Os04g43360.2	upstream_gene_variant ; 3815.0bp to feature; MODIFIER	silent_mutation	Average:25.672; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0425648422	C -> A	LOC_Os04g43380.1	downstream_gene_variant ; 1710.0bp to feature; MODIFIER	silent_mutation	Average:25.672; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0425648422	C -> A	LOC_Os04g43370-LOC_Os04g43380	intergenic_region ; MODIFIER	silent_mutation	Average:25.672; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0425648422	7.94E-06	NA	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422	NA	2.78E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422	8.67E-06	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422	NA	2.89E-29	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422	NA	3.42E-20	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422	NA	1.45E-06	mr1858	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422	NA	1.45E-06	mr1859	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422	NA	5.70E-07	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422	NA	1.77E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422	NA	9.29E-17	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422	NA	2.33E-10	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422	NA	2.65E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422	NA	3.44E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425648422	NA	1.17E-13	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251