\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0425623927:

Variant ID: vg0425623927 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 25623927
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTATCAACAATAAAGTTGTATAACTCATCAAGATCTATAACTTTTACTTTGGTCTTTTTTTCTATATAACATTTTTTGAACAATTTGAATTTGAATTT[A/G]
AAAATATGACAACTTCAAACAATATTTTCAAATACTAAATGATTTCAACTTAAAAAGCCATCAACAACAAAATTGTATAACTCATCAATATCTATAACTT

Reverse complement sequence

AAGTTATAGATATTGATGAGTTATACAATTTTGTTGTTGATGGCTTTTTAAGTTGAAATCATTTAGTATTTGAAAATATTGTTTGAAGTTGTCATATTTT[T/C]
AAATTCAAATTCAAATTGTTCAAAAAATGTTATATAGAAAAAAAGACCAAAGTAAAAGTTATAGATCTTGATGAGTTATACAACTTTATTGTTGATAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 3.70% 3.05% 0.11% NA
All Indica  2759 92.40% 4.80% 2.65% 0.14% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 62.50% 14.10% 23.05% 0.37% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.90% 0.20% 0.86% 0.00% NA
Indica III  913 82.70% 12.40% 4.60% 0.33% NA
Indica Intermediate  786 94.10% 2.30% 3.44% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 0.00% 4.17% 0.00% NA
Intermediate  90 92.20% 4.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0425623927 A -> DEL N N silent_mutation Average:16.633; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0425623927 A -> G LOC_Os04g43310.1 upstream_gene_variant ; 4355.0bp to feature; MODIFIER silent_mutation Average:16.633; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0425623927 A -> G LOC_Os04g43324.1 upstream_gene_variant ; 3186.0bp to feature; MODIFIER silent_mutation Average:16.633; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0425623927 A -> G LOC_Os04g43310-LOC_Os04g43324 intergenic_region ; MODIFIER silent_mutation Average:16.633; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0425623927 4.34E-07 NA mr1580_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425623927 5.79E-06 NA mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251