\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0425557776:

Variant ID: vg0425557776 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 25557776
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGTAAATCCAAACATATCCCAGCCTTGAGCTTCAACCTCCAAGATTCCTCCTTTTTCCTCTTTCTTTGGAAACCACCCCAAATAATTCTTCGGCTCTC[T/C]
AGATACAAAACCAATTCGAAAATATTGAGTTTTCACTTTGATCTCCCTTCCTTGACTCCACCATATTCCCATGAGTCCAAATATCAAGTTCGAAATTCAA

Reverse complement sequence

TTGAATTTCGAACTTGATATTTGGACTCATGGGAATATGGTGGAGTCAAGGAAGGGAGATCAAAGTGAAAACTCAATATTTTCGAATTGGTTTTGTATCT[A/G]
GAGAGCCGAAGAATTATTTGGGGTGGTTTCCAAAGAAAGAGGAAAAAGGAGGAATCTTGGAGGTTGAAGCTCAAGGCTGGGATATGTTTGGATTTACATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 34.50% 9.90% 0.04% NA
All Indica  2759 80.20% 8.60% 11.20% 0.00% NA
All Japonica  1512 9.10% 89.00% 1.98% 0.00% NA
Aus  269 55.00% 0.40% 43.87% 0.74% NA
Indica I  595 80.20% 13.90% 5.88% 0.00% NA
Indica II  465 93.10% 2.80% 4.09% 0.00% NA
Indica III  913 76.30% 3.10% 20.59% 0.00% NA
Indica Intermediate  786 77.20% 14.20% 8.52% 0.00% NA
Temperate Japonica  767 4.40% 93.00% 2.61% 0.00% NA
Tropical Japonica  504 11.30% 87.90% 0.79% 0.00% NA
Japonica Intermediate  241 19.10% 78.40% 2.49% 0.00% NA
VI/Aromatic  96 83.30% 15.60% 1.04% 0.00% NA
Intermediate  90 50.00% 38.90% 11.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0425557776 T -> C LOC_Os04g43164.1 upstream_gene_variant ; 3976.0bp to feature; MODIFIER silent_mutation Average:38.042; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0425557776 T -> C LOC_Os04g43170.1 upstream_gene_variant ; 1316.0bp to feature; MODIFIER silent_mutation Average:38.042; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0425557776 T -> C LOC_Os04g43190.1 upstream_gene_variant ; 3868.0bp to feature; MODIFIER silent_mutation Average:38.042; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0425557776 T -> C LOC_Os04g43164.2 upstream_gene_variant ; 3976.0bp to feature; MODIFIER silent_mutation Average:38.042; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0425557776 T -> C LOC_Os04g43180.1 downstream_gene_variant ; 1235.0bp to feature; MODIFIER silent_mutation Average:38.042; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0425557776 T -> C LOC_Os04g43170-LOC_Os04g43180 intergenic_region ; MODIFIER silent_mutation Average:38.042; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0425557776 T -> DEL N N silent_mutation Average:38.042; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0425557776 1.78E-06 2.45E-08 mr1274 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425557776 NA 3.47E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425557776 NA 1.12E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425557776 NA 4.07E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425557776 NA 1.56E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425557776 NA 3.87E-15 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425557776 NA 5.86E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425557776 NA 4.10E-09 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251