Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0425557776:

Variant ID: vg0425557776 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 25557776
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGTAAATCCAAACATATCCCAGCCTTGAGCTTCAACCTCCAAGATTCCTCCTTTTTCCTCTTTCTTTGGAAACCACCCCAAATAATTCTTCGGCTCTC[T/C]
AGATACAAAACCAATTCGAAAATATTGAGTTTTCACTTTGATCTCCCTTCCTTGACTCCACCATATTCCCATGAGTCCAAATATCAAGTTCGAAATTCAA

Reverse complement sequence

TTGAATTTCGAACTTGATATTTGGACTCATGGGAATATGGTGGAGTCAAGGAAGGGAGATCAAAGTGAAAACTCAATATTTTCGAATTGGTTTTGTATCT[A/G]
GAGAGCCGAAGAATTATTTGGGGTGGTTTCCAAAGAAAGAGGAAAAAGGAGGAATCTTGGAGGTTGAAGCTCAAGGCTGGGATATGTTTGGATTTACATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.50%	34.50%	9.90%	0.04%	NA
All Indica	2759	80.20%	8.60%	11.20%	0.00%	NA
All Japonica	1512	9.10%	89.00%	1.98%	0.00%	NA
Aus	269	55.00%	0.40%	43.87%	0.74%	NA
Indica I	595	80.20%	13.90%	5.88%	0.00%	NA
Indica II	465	93.10%	2.80%	4.09%	0.00%	NA
Indica III	913	76.30%	3.10%	20.59%	0.00%	NA
Indica Intermediate	786	77.20%	14.20%	8.52%	0.00%	NA
Temperate Japonica	767	4.40%	93.00%	2.61%	0.00%	NA
Tropical Japonica	504	11.30%	87.90%	0.79%	0.00%	NA
Japonica Intermediate	241	19.10%	78.40%	2.49%	0.00%	NA
VI/Aromatic	96	83.30%	15.60%	1.04%	0.00%	NA
Intermediate	90	50.00%	38.90%	11.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0425557776	T -> C	LOC_Os04g43164.1	upstream_gene_variant ; 3976.0bp to feature; MODIFIER	silent_mutation	Average:38.042; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0425557776	T -> C	LOC_Os04g43170.1	upstream_gene_variant ; 1316.0bp to feature; MODIFIER	silent_mutation	Average:38.042; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0425557776	T -> C	LOC_Os04g43190.1	upstream_gene_variant ; 3868.0bp to feature; MODIFIER	silent_mutation	Average:38.042; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0425557776	T -> C	LOC_Os04g43164.2	upstream_gene_variant ; 3976.0bp to feature; MODIFIER	silent_mutation	Average:38.042; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0425557776	T -> C	LOC_Os04g43180.1	downstream_gene_variant ; 1235.0bp to feature; MODIFIER	silent_mutation	Average:38.042; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0425557776	T -> C	LOC_Os04g43170-LOC_Os04g43180	intergenic_region ; MODIFIER	silent_mutation	Average:38.042; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0425557776	T -> DEL	N	N	silent_mutation	Average:38.042; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0425557776	1.78E-06	2.45E-08	mr1274	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425557776	NA	3.47E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425557776	NA	1.12E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425557776	NA	4.07E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425557776	NA	1.56E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425557776	NA	3.87E-15	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425557776	NA	5.86E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425557776	NA	4.10E-09	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251