Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0425304166:

Variant ID: vg0425304166 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 25304166
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCCGCAAGGTAGACTCGGCCCACCGGCCCTCTCTCTCCCTCACTCTCCCCGCGCCCCCTTGGGCCGCCTCTCCGGGCCGGCCGGCCCATTAGTTCGGC[T/C]
GAGCCATGCCTCCCCTCTTGGGCCGCACCCAAGCCGCCCGAGGAAGTCTAAATCATATCCCTCCTTCAATTTCTTTCCAGAAAGGGTTTAATAAATTATT

Reverse complement sequence

AATAATTTATTAAACCCTTTCTGGAAAGAAATTGAAGGAGGGATATGATTTAGACTTCCTCGGGCGGCTTGGGTGCGGCCCAAGAGGGGAGGCATGGCTC[A/G]
GCCGAACTAATGGGCCGGCCGGCCCGGAGAGGCGGCCCAAGGGGGCGCGGGGAGAGTGAGGGAGAGAGAGGGCCGGTGGGCCGAGTCTACCTTGCGGGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 35.70% 4.63% 1.69% NA
All Indica  2759 87.00% 7.40% 4.68% 1.01% NA
All Japonica  1512 4.80% 94.60% 0.53% 0.07% NA
Aus  269 53.90% 0.70% 27.14% 18.22% NA
Indica I  595 90.10% 9.60% 0.17% 0.17% NA
Indica II  465 95.50% 3.00% 1.08% 0.43% NA
Indica III  913 85.30% 3.30% 10.30% 1.10% NA
Indica Intermediate  786 81.40% 13.00% 3.69% 1.91% NA
Temperate Japonica  767 1.30% 98.20% 0.52% 0.00% NA
Tropical Japonica  504 7.30% 92.50% 0.00% 0.20% NA
Japonica Intermediate  241 10.80% 87.60% 1.66% 0.00% NA
VI/Aromatic  96 89.60% 7.30% 3.12% 0.00% NA
Intermediate  90 42.20% 48.90% 6.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0425304166 T -> C LOC_Os04g42760.1 upstream_gene_variant ; 2977.0bp to feature; MODIFIER silent_mutation Average:70.063; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0425304166 T -> C LOC_Os04g42740.1 downstream_gene_variant ; 4597.0bp to feature; MODIFIER silent_mutation Average:70.063; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0425304166 T -> C LOC_Os04g42750.1 intron_variant ; MODIFIER silent_mutation Average:70.063; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0425304166 T -> DEL N N silent_mutation Average:70.063; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0425304166 T C 0.0 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0425304166 NA 1.14E-11 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 1.26E-12 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 5.97E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 9.31E-25 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 1.24E-13 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 2.27E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 2.92E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 1.98E-20 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 9.49E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 2.75E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 5.00E-16 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 1.14E-14 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 1.75E-15 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 4.31E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 1.67E-26 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 8.76E-20 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 7.82E-10 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 5.20E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 4.50E-06 NA mr1706_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 5.30E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 1.43E-19 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 4.41E-16 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 4.53E-16 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 7.84E-17 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 2.89E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425304166 NA 3.49E-09 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251