\
| Variant ID: vg0425123848 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 25123848 |
| Reference Allele: C | Alternative Allele: A,CGA |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, C: 0.13, others allele: 0.00, population size: 62. )
CGCAAAGCCTATGCCGCCGCGCGGGCGCGGGAGCGGCGCCACGAGAAGGTTCGGGCCTATAACATGCGCTGGCAACGCCCACCGAAACATGACGCCGCCG[C/A,CGA]
CGACGACGACTGGGAAGTGTAACATCCCGGCCTAGGGCTTAATAGGATTAATAGAATACTCATATCAACAAGTTGCAACTTCTTTTCCAGAAGCCAATCT
AGATTGGCTTCTGGAAAAGAAGTTGCAACTTGTTGATATGAGTATTCTATTAATCCTATTAAGCCCTAGGCCGGGATGTTACACTTCCCAGTCGTCGTCG[G/T,TCG]
CGGCGGCGTCATGTTTCGGTGGGCGTTGCCAGCGCATGTTATAGGCCCGAACCTTCTCGTGGCGCCGCTCCCGCGCCCGCGCGGCGGCATAGGCTTTGCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.60% | 12.50% | 3.87% | 0.00% | CGA: 0.02% |
| All Indica | 2759 | 97.20% | 0.80% | 2.03% | 0.00% | CGA: 0.04% |
| All Japonica | 1512 | 56.20% | 36.00% | 7.80% | 0.00% | NA |
| Aus | 269 | 97.80% | 0.40% | 1.86% | 0.00% | NA |
| Indica I | 595 | 97.30% | 0.70% | 2.02% | 0.00% | NA |
| Indica II | 465 | 98.50% | 0.20% | 1.29% | 0.00% | NA |
| Indica III | 913 | 97.90% | 0.50% | 1.42% | 0.00% | CGA: 0.11% |
| Indica Intermediate | 786 | 95.40% | 1.40% | 3.18% | 0.00% | NA |
| Temperate Japonica | 767 | 25.70% | 63.00% | 11.34% | 0.00% | NA |
| Tropical Japonica | 504 | 93.10% | 5.40% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.30% | 14.10% | 9.54% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 13.30% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0425123848 | C -> A | LOC_Os04g42444.1 | upstream_gene_variant ; 3303.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> A | LOC_Os04g42451.1 | upstream_gene_variant ; 1155.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> A | LOC_Os04g42444.2 | upstream_gene_variant ; 3303.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> A | LOC_Os04g42470.1 | downstream_gene_variant ; 2867.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> A | LOC_Os04g42470.4 | downstream_gene_variant ; 2867.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> A | LOC_Os04g42470.7 | downstream_gene_variant ; 2867.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> A | LOC_Os04g42470.2 | downstream_gene_variant ; 2867.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> A | LOC_Os04g42470.3 | downstream_gene_variant ; 2867.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> A | LOC_Os04g42470.5 | downstream_gene_variant ; 2867.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> A | LOC_Os04g42470.6 | downstream_gene_variant ; 2867.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> A | LOC_Os04g42470.8 | downstream_gene_variant ; 4298.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> A | LOC_Os04g42460.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> CGA | LOC_Os04g42444.1 | upstream_gene_variant ; 3304.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> CGA | LOC_Os04g42451.1 | upstream_gene_variant ; 1156.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> CGA | LOC_Os04g42444.2 | upstream_gene_variant ; 3304.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> CGA | LOC_Os04g42470.1 | downstream_gene_variant ; 2866.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> CGA | LOC_Os04g42470.4 | downstream_gene_variant ; 2866.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> CGA | LOC_Os04g42470.7 | downstream_gene_variant ; 2866.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> CGA | LOC_Os04g42470.2 | downstream_gene_variant ; 2866.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> CGA | LOC_Os04g42470.3 | downstream_gene_variant ; 2866.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> CGA | LOC_Os04g42470.5 | downstream_gene_variant ; 2866.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> CGA | LOC_Os04g42470.6 | downstream_gene_variant ; 2866.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> CGA | LOC_Os04g42470.8 | downstream_gene_variant ; 4297.0bp to feature; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0425123848 | C -> CGA | LOC_Os04g42460.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0425123848 | NA | 2.07E-15 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0425123848 | NA | 5.67E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 8.84E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 3.44E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 2.22E-06 | mr1205 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 3.48E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 1.59E-06 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | 6.46E-06 | 6.46E-06 | mr1420 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 2.65E-06 | mr1492 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 5.97E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 2.92E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | 1.00E-06 | 1.00E-06 | mr1802 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 8.65E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 9.80E-07 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 1.01E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 2.19E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 5.38E-07 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 2.25E-08 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 1.47E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 2.13E-09 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 1.69E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 4.23E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 2.05E-06 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 4.08E-06 | mr1441_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 4.43E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 9.86E-07 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 1.87E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 7.69E-09 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 1.14E-07 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 9.20E-06 | mr1892_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | 5.34E-06 | 5.32E-06 | mr1919_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0425123848 | NA | 5.23E-07 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |