\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0425123848:

Variant ID: vg0425123848 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 25123848
Reference Allele: CAlternative Allele: A,CGA
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, C: 0.13, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:


CGCAAAGCCTATGCCGCCGCGCGGGCGCGGGAGCGGCGCCACGAGAAGGTTCGGGCCTATAACATGCGCTGGCAACGCCCACCGAAACATGACGCCGCCG[C/A,CGA]
CGACGACGACTGGGAAGTGTAACATCCCGGCCTAGGGCTTAATAGGATTAATAGAATACTCATATCAACAAGTTGCAACTTCTTTTCCAGAAGCCAATCT

Reverse complement sequence

AGATTGGCTTCTGGAAAAGAAGTTGCAACTTGTTGATATGAGTATTCTATTAATCCTATTAAGCCCTAGGCCGGGATGTTACACTTCCCAGTCGTCGTCG[G/T,TCG]
CGGCGGCGTCATGTTTCGGTGGGCGTTGCCAGCGCATGTTATAGGCCCGAACCTTCTCGTGGCGCCGCTCCCGCGCCCGCGCGGCGGCATAGGCTTTGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.60% 12.50% 3.87% 0.00% CGA: 0.02%
All Indica  2759 97.20% 0.80% 2.03% 0.00% CGA: 0.04%
All Japonica  1512 56.20% 36.00% 7.80% 0.00% NA
Aus  269 97.80% 0.40% 1.86% 0.00% NA
Indica I  595 97.30% 0.70% 2.02% 0.00% NA
Indica II  465 98.50% 0.20% 1.29% 0.00% NA
Indica III  913 97.90% 0.50% 1.42% 0.00% CGA: 0.11%
Indica Intermediate  786 95.40% 1.40% 3.18% 0.00% NA
Temperate Japonica  767 25.70% 63.00% 11.34% 0.00% NA
Tropical Japonica  504 93.10% 5.40% 1.59% 0.00% NA
Japonica Intermediate  241 76.30% 14.10% 9.54% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 82.20% 13.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0425123848 C -> A LOC_Os04g42444.1 upstream_gene_variant ; 3303.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> A LOC_Os04g42451.1 upstream_gene_variant ; 1155.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> A LOC_Os04g42444.2 upstream_gene_variant ; 3303.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> A LOC_Os04g42470.1 downstream_gene_variant ; 2867.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> A LOC_Os04g42470.4 downstream_gene_variant ; 2867.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> A LOC_Os04g42470.7 downstream_gene_variant ; 2867.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> A LOC_Os04g42470.2 downstream_gene_variant ; 2867.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> A LOC_Os04g42470.3 downstream_gene_variant ; 2867.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> A LOC_Os04g42470.5 downstream_gene_variant ; 2867.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> A LOC_Os04g42470.6 downstream_gene_variant ; 2867.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> A LOC_Os04g42470.8 downstream_gene_variant ; 4298.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> A LOC_Os04g42460.1 intron_variant ; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> CGA LOC_Os04g42444.1 upstream_gene_variant ; 3304.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> CGA LOC_Os04g42451.1 upstream_gene_variant ; 1156.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> CGA LOC_Os04g42444.2 upstream_gene_variant ; 3304.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> CGA LOC_Os04g42470.1 downstream_gene_variant ; 2866.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> CGA LOC_Os04g42470.4 downstream_gene_variant ; 2866.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> CGA LOC_Os04g42470.7 downstream_gene_variant ; 2866.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> CGA LOC_Os04g42470.2 downstream_gene_variant ; 2866.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> CGA LOC_Os04g42470.3 downstream_gene_variant ; 2866.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> CGA LOC_Os04g42470.5 downstream_gene_variant ; 2866.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> CGA LOC_Os04g42470.6 downstream_gene_variant ; 2866.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> CGA LOC_Os04g42470.8 downstream_gene_variant ; 4297.0bp to feature; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0425123848 C -> CGA LOC_Os04g42460.1 intron_variant ; MODIFIER silent_mutation Average:56.508; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0425123848 NA 2.07E-15 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425123848 NA 5.67E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 8.84E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 3.44E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 2.22E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 3.48E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 1.59E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 6.46E-06 6.46E-06 mr1420 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 2.65E-06 mr1492 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 5.97E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 2.92E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 1.00E-06 1.00E-06 mr1802 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 8.65E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 9.80E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 1.01E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 2.19E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 5.38E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 2.25E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 1.47E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 2.13E-09 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 1.69E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 4.23E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 2.05E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 4.08E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 4.43E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 9.86E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 1.87E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 7.69E-09 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 1.14E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 9.20E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 5.34E-06 5.32E-06 mr1919_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425123848 NA 5.23E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251