Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0425061026:

Variant ID: vg0425061026 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 25061026
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAACTCGCATGCTGGAGCAAAATTTTCAGAAAAATGCATAATTAAGTTTCATGCATGCAAAGTTAGCTATCCTCCTTCACCTGGTCGTCTCATTCATC[A/G]
ATCCATGCCGATCGCGTGCTCTCTCCTGGCCACCGCAACGCCTGAGAAAACGCGAAAGACCTGACAATTACACGGATTGGTAGAGGTAATAATCTAGCTG

Reverse complement sequence

CAGCTAGATTATTACCTCTACCAATCCGTGTAATTGTCAGGTCTTTCGCGTTTTCTCAGGCGTTGCGGTGGCCAGGAGAGAGCACGCGATCGGCATGGAT[T/C]
GATGAATGAGACGACCAGGTGAAGGAGGATAGCTAACTTTGCATGCATGAAACTTAATTATGCATTTTTCTGAAAATTTTGCTCCAGCATGCGAGTTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 9.00% 2.37% 0.00% NA
All Indica  2759 99.60% 0.20% 0.25% 0.00% NA
All Japonica  1512 66.50% 27.00% 6.55% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 99.00% 0.30% 0.67% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.40% 0.38% 0.00% NA
Temperate Japonica  767 38.70% 50.50% 10.82% 0.00% NA
Tropical Japonica  504 97.40% 0.40% 2.18% 0.00% NA
Japonica Intermediate  241 90.00% 7.90% 2.07% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 86.70% 10.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0425061026 A -> G LOC_Os04g42360.1 upstream_gene_variant ; 1492.0bp to feature; MODIFIER silent_mutation Average:62.928; most accessible tissue: Callus, score: 79.527 N N N N
vg0425061026 A -> G LOC_Os04g42340.1 downstream_gene_variant ; 2055.0bp to feature; MODIFIER silent_mutation Average:62.928; most accessible tissue: Callus, score: 79.527 N N N N
vg0425061026 A -> G LOC_Os04g42350.1 intron_variant ; MODIFIER silent_mutation Average:62.928; most accessible tissue: Callus, score: 79.527 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0425061026 NA 1.30E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0425061026 NA 5.27E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 4.87E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 1.41E-11 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 9.10E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 5.00E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 8.37E-06 NA mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 1.81E-07 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 4.52E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 6.56E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 1.98E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 2.16E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 3.18E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 6.06E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 2.53E-06 1.24E-07 mr1596 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 9.04E-06 3.69E-08 mr1596 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 7.35E-06 NA mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 4.03E-11 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 2.07E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 3.81E-08 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 1.70E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 6.30E-07 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 1.52E-07 mr1775 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 1.29E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 1.78E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 2.73E-11 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 3.20E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 2.32E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 5.90E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 3.12E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 6.56E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 1.76E-09 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 4.77E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 2.39E-08 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 3.72E-09 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0425061026 NA 1.91E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251