\
| Variant ID: vg0424988272 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 24988272 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAATAGTATAAAAGTTAGTAGGTGGAAGAATAAATTAGGCATGGTTTAGTTTCCAATTTTTTCTTCAAACTTTCAATTTTTCCATCACATCGATCAAAA[T/C]
TTTCCTTCACACATAAACTTCCAACTTTTTTCTTCAAACTTTTAATTTTAGTCAAACTTCTAATTTTGGTGTGGAACTAGACACAGCTTTAATATAAAAG
CTTTTATATTAAAGCTGTGTCTAGTTCCACACCAAAATTAGAAGTTTGACTAAAATTAAAAGTTTGAAGAAAAAAGTTGGAAGTTTATGTGTGAAGGAAA[A/G]
TTTTGATCGATGTGATGGAAAAATTGAAAGTTTGAAGAAAAAATTGGAAACTAAACCATGCCTAATTTATTCTTCCACCTACTAACTTTTATACTATTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.50% | 41.70% | 1.44% | 3.30% | NA |
| All Indica | 2759 | 88.80% | 6.90% | 1.59% | 2.79% | NA |
| All Japonica | 1512 | 0.80% | 99.10% | 0.07% | 0.07% | NA |
| Aus | 269 | 12.60% | 52.00% | 8.18% | 27.14% | NA |
| Indica I | 595 | 88.40% | 10.10% | 1.34% | 0.17% | NA |
| Indica II | 465 | 95.90% | 3.20% | 0.65% | 0.22% | NA |
| Indica III | 913 | 90.10% | 2.30% | 2.41% | 5.15% | NA |
| Indica Intermediate | 786 | 83.20% | 11.80% | 1.40% | 3.56% | NA |
| Temperate Japonica | 767 | 0.30% | 99.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 1.80% | 98.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 97.90% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 37.80% | 56.70% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0424988272 | T -> C | LOC_Os04g42240-LOC_Os04g42250 | intergenic_region ; MODIFIER | silent_mutation | Average:49.448; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0424988272 | T -> DEL | N | N | silent_mutation | Average:49.448; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0424988272 | NA | 3.39E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424988272 | NA | 1.42E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424988272 | NA | 1.05E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424988272 | NA | 9.49E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424988272 | NA | 1.03E-09 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424988272 | NA | 9.95E-06 | mr1373_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424988272 | 3.46E-06 | 3.46E-06 | mr1417_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424988272 | NA | 9.66E-07 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424988272 | NA | 8.87E-15 | mr1578_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424988272 | NA | 2.68E-14 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424988272 | NA | 4.27E-12 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424988272 | NA | 2.05E-16 | mr1686_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424988272 | 2.42E-06 | 4.31E-06 | mr1686_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424988272 | NA | 2.53E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424988272 | NA | 1.98E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424988272 | NA | 7.25E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |