\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424988272:

Variant ID: vg0424988272 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 24988272
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAATAGTATAAAAGTTAGTAGGTGGAAGAATAAATTAGGCATGGTTTAGTTTCCAATTTTTTCTTCAAACTTTCAATTTTTCCATCACATCGATCAAAA[T/C]
TTTCCTTCACACATAAACTTCCAACTTTTTTCTTCAAACTTTTAATTTTAGTCAAACTTCTAATTTTGGTGTGGAACTAGACACAGCTTTAATATAAAAG

Reverse complement sequence

CTTTTATATTAAAGCTGTGTCTAGTTCCACACCAAAATTAGAAGTTTGACTAAAATTAAAAGTTTGAAGAAAAAAGTTGGAAGTTTATGTGTGAAGGAAA[A/G]
TTTTGATCGATGTGATGGAAAAATTGAAAGTTTGAAGAAAAAATTGGAAACTAAACCATGCCTAATTTATTCTTCCACCTACTAACTTTTATACTATTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.50% 41.70% 1.44% 3.30% NA
All Indica  2759 88.80% 6.90% 1.59% 2.79% NA
All Japonica  1512 0.80% 99.10% 0.07% 0.07% NA
Aus  269 12.60% 52.00% 8.18% 27.14% NA
Indica I  595 88.40% 10.10% 1.34% 0.17% NA
Indica II  465 95.90% 3.20% 0.65% 0.22% NA
Indica III  913 90.10% 2.30% 2.41% 5.15% NA
Indica Intermediate  786 83.20% 11.80% 1.40% 3.56% NA
Temperate Japonica  767 0.30% 99.60% 0.13% 0.00% NA
Tropical Japonica  504 1.80% 98.00% 0.00% 0.20% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 97.90% 0.00% 1.04% NA
Intermediate  90 37.80% 56.70% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424988272 T -> C LOC_Os04g42240-LOC_Os04g42250 intergenic_region ; MODIFIER silent_mutation Average:49.448; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0424988272 T -> DEL N N silent_mutation Average:49.448; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0424988272 NA 3.39E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424988272 NA 1.42E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424988272 NA 1.05E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424988272 NA 9.49E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424988272 NA 1.03E-09 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424988272 NA 9.95E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424988272 3.46E-06 3.46E-06 mr1417_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424988272 NA 9.66E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424988272 NA 8.87E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424988272 NA 2.68E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424988272 NA 4.27E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424988272 NA 2.05E-16 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424988272 2.42E-06 4.31E-06 mr1686_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424988272 NA 2.53E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424988272 NA 1.98E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424988272 NA 7.25E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251