\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424956229:

Variant ID: vg0424956229 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 24956229
Reference Allele: AAlternative Allele: G,ATG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ACACCGTCGTCAATGTGTTGGGCACAAGCGACGTGGCACAATACACCGTCGTCAAGATAAAGTAGCAACTGCACCACACGCAATATTTGGGTGTACAATC[A/G,ATG]
TGTGCTGGTGGCCACTAAGAAAGAGAGAGAAGGGATGGAGGGAGAGAAGAGGGGCAATGATTTATGGGTCTCGCTATAATTTTTTTGTTTTCTTAACTAG

Reverse complement sequence

CTAGTTAAGAAAACAAAAAAATTATAGCGAGACCCATAAATCATTGCCCCTCTTCTCTCCCTCCATCCCTTCTCTCTCTTTCTTAGTGGCCACCAGCACA[T/C,CAT]
GATTGTACACCCAAATATTGCGTGTGGTGCAGTTGCTACTTTATCTTGACGACGGTGTATTGTGCCACGTCGCTTGTGCCCAACACATTGACGACGGTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 41.80% 0.04% 0.36% ATG: 0.42%
All Indica  2759 92.30% 6.90% 0.04% 0.54% ATG: 0.18%
All Japonica  1512 0.90% 99.10% 0.00% 0.07% NA
Aus  269 42.40% 52.00% 0.00% 0.00% ATG: 5.58%
Indica I  595 88.70% 10.10% 0.17% 1.01% NA
Indica II  465 96.30% 3.20% 0.00% 0.43% NA
Indica III  913 97.20% 2.40% 0.00% 0.11% ATG: 0.33%
Indica Intermediate  786 87.00% 12.00% 0.00% 0.76% ATG: 0.25%
Temperate Japonica  767 0.30% 99.60% 0.00% 0.13% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 40.00% 57.80% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424956229 A -> ATG LOC_Os04g42140.1 upstream_gene_variant ; 3948.0bp to feature; MODIFIER silent_mutation Average:84.244; most accessible tissue: Callus, score: 97.263 N N N N
vg0424956229 A -> ATG LOC_Os04g42150.1 upstream_gene_variant ; 2427.0bp to feature; MODIFIER silent_mutation Average:84.244; most accessible tissue: Callus, score: 97.263 N N N N
vg0424956229 A -> ATG LOC_Os04g42140-LOC_Os04g42150 intergenic_region ; MODIFIER silent_mutation Average:84.244; most accessible tissue: Callus, score: 97.263 N N N N
vg0424956229 A -> DEL N N silent_mutation Average:84.244; most accessible tissue: Callus, score: 97.263 N N N N
vg0424956229 A -> G LOC_Os04g42140.1 upstream_gene_variant ; 3947.0bp to feature; MODIFIER silent_mutation Average:84.244; most accessible tissue: Callus, score: 97.263 N N N N
vg0424956229 A -> G LOC_Os04g42150.1 upstream_gene_variant ; 2428.0bp to feature; MODIFIER silent_mutation Average:84.244; most accessible tissue: Callus, score: 97.263 N N N N
vg0424956229 A -> G LOC_Os04g42140-LOC_Os04g42150 intergenic_region ; MODIFIER silent_mutation Average:84.244; most accessible tissue: Callus, score: 97.263 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0424956229 A ATG 0.13 0.08 -0.02 0.06 -0.05 -0.05
vg0424956229 A G 0.01 0.01 0.02 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0424956229 NA 3.60E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 7.17E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 1.32E-06 1.32E-06 mr1192_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 2.84E-06 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 3.21E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 5.66E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 1.83E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 5.89E-06 8.16E-08 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 1.93E-06 1.93E-06 mr1329_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 1.45E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 7.60E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 1.68E-06 1.68E-06 mr1337_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 6.61E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 2.68E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 4.30E-06 4.30E-06 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 6.84E-06 6.84E-06 mr1417_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 4.16E-17 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 1.01E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 9.83E-06 9.83E-06 mr1524_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 2.54E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 4.37E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 8.13E-06 8.13E-06 mr1674_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 1.91E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 1.85E-06 1.84E-06 mr1688_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 2.87E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 3.21E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 5.74E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 2.06E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424956229 NA 8.65E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251