RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0424939205:

Variant ID: vg0424939205 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 24939205
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTAATATAATAATAATATTTTTATCGATGGTTATCATTTTTAAAATTTAGTTTTTTTTAATTTCTAACGGTGTGGCATTGAAGTTGACACTAAATAGAT[G/A]
AATTCATGAATATGAAAATTTTTCGACCGTTTCTGCTTGTTTTTTAAAAAATAATAAAATAATGATGCCGTTTCCGACCATTTCCAACCACTTTCATCCC

Reverse complement sequence

GGGATGAAAGTGGTTGGAAATGGTCGGAAACGGCATCATTATTTTATTATTTTTTAAAAAACAAGCAGAAACGGTCGAAAAATTTTCATATTCATGAATT[C/T]
ATCTATTTAGTGTCAACTTCAATGCCACACCGTTAGAAATTAAAAAAAACTAAATTTTAAAAATGATAACCATCGATAAAAATATTATTATTATATTAGT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.40%	3.00%	1.29%	36.35%	NA
All Indica	2759	37.10%	0.20%	1.52%	61.22%	NA
All Japonica	1512	89.90%	8.60%	0.93%	0.53%	NA
Aus	269	98.10%	0.00%	1.49%	0.37%	NA
Indica I	595	45.40%	0.00%	1.85%	52.77%	NA
Indica II	465	18.30%	0.00%	1.29%	80.43%	NA
Indica III	913	34.00%	0.20%	1.53%	64.29%	NA
Indica Intermediate	786	45.50%	0.40%	1.40%	52.67%	NA
Temperate Japonica	767	99.70%	0.00%	0.13%	0.13%	NA
Tropical Japonica	504	71.80%	24.80%	2.18%	1.19%	NA
Japonica Intermediate	241	96.70%	2.10%	0.83%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	71.10%	6.70%	1.11%	21.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0424939205	G -> DEL	N	N	silent_mutation	Average:13.156; most accessible tissue: Callus, score: 76.217	N	N	N	N
vg0424939205	G -> A	LOC_Os04g42120.1	upstream_gene_variant ; 423.0bp to feature; MODIFIER	silent_mutation	Average:13.156; most accessible tissue: Callus, score: 76.217	N	N	N	N
vg0424939205	G -> A	LOC_Os04g42130.1	upstream_gene_variant ; 1256.0bp to feature; MODIFIER	silent_mutation	Average:13.156; most accessible tissue: Callus, score: 76.217	N	N	N	N
vg0424939205	G -> A	LOC_Os04g42110.1	downstream_gene_variant ; 3127.0bp to feature; MODIFIER	silent_mutation	Average:13.156; most accessible tissue: Callus, score: 76.217	N	N	N	N
vg0424939205	G -> A	LOC_Os04g42134.1	downstream_gene_variant ; 3916.0bp to feature; MODIFIER	silent_mutation	Average:13.156; most accessible tissue: Callus, score: 76.217	N	N	N	N
vg0424939205	G -> A	LOC_Os04g42120-LOC_Os04g42130	intergenic_region ; MODIFIER	silent_mutation	Average:13.156; most accessible tissue: Callus, score: 76.217	N	N	N	N

Showing 1 to 6 of 6 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0424939205	1.30E-06	NA	mr1668	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 1 of 1 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0424939205:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact