\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424931173:

Variant ID: vg0424931173 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 24931173
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.02, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTCGCCGGCCAACCACCGGTGGCAGTGTTCATCAGAATTCTGGTAGGGACAGGCGTAATGGGTATACTAGCTTAGAATCACGTAGCAAAAGAATTAAC[G/A]
CAACTCCGGATATAGAGTATCACGCGAAGCCAAAAGCAAGGTGTCTCACGACTGACTAAAAGTTGACCCTACCTGACCAACATTCGAAAAAAAAAGAACC

Reverse complement sequence

GGTTCTTTTTTTTTCGAATGTTGGTCAGGTAGGGTCAACTTTTAGTCAGTCGTGAGACACCTTGCTTTTGGCTTCGCGTGATACTCTATATCCGGAGTTG[C/T]
GTTAATTCTTTTGCTACGTGATTCTAAGCTAGTATACCCATTACGCCTGTCCCTACCAGAATTCTGATGAACACTGCCACCGGTGGTTGGCCGGCGAAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 42.30% 5.52% 3.85% NA
All Indica  2759 13.20% 71.00% 9.28% 6.52% NA
All Japonica  1512 99.10% 0.80% 0.07% 0.00% NA
Aus  269 97.00% 2.60% 0.00% 0.37% NA
Indica I  595 10.10% 72.10% 13.61% 4.20% NA
Indica II  465 3.70% 80.00% 10.11% 6.24% NA
Indica III  913 15.20% 69.40% 5.70% 9.64% NA
Indica Intermediate  786 19.00% 66.50% 9.67% 4.83% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 67.80% 26.70% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424931173 G -> DEL N N silent_mutation Average:62.133; most accessible tissue: Callus, score: 88.785 N N N N
vg0424931173 G -> A LOC_Os04g42110.1 upstream_gene_variant ; 912.0bp to feature; MODIFIER silent_mutation Average:62.133; most accessible tissue: Callus, score: 88.785 N N N N
vg0424931173 G -> A LOC_Os04g42120.1 downstream_gene_variant ; 4284.0bp to feature; MODIFIER silent_mutation Average:62.133; most accessible tissue: Callus, score: 88.785 N N N N
vg0424931173 G -> A LOC_Os04g42100-LOC_Os04g42110 intergenic_region ; MODIFIER silent_mutation Average:62.133; most accessible tissue: Callus, score: 88.785 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0424931173 G A -0.14 -0.03 -0.02 -0.04 -0.08 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0424931173 NA 4.68E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 NA 9.67E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 NA 1.31E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 NA 8.16E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 NA 2.61E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 3.95E-06 3.95E-06 mr1417_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 NA 1.41E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 NA 9.85E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 NA 2.09E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 1.01E-06 1.01E-06 mr1621_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 NA 6.79E-17 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 NA 9.01E-06 mr1686_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 NA 2.42E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 NA 4.16E-15 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 NA 3.47E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 NA 3.21E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424931173 NA 8.47E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251