Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0424824884:

Variant ID: vg0424824884 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 24824884
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTGAGTGGTCAGAAACGAATCTGTGTGATTCGGGATGTCTACGGGCATCATAAATTAGGCTTCCCGAGTGGAAACAGATTGTTATGCTGCTGGGCAGCT[G/A]
GACTCTGGGAGTCCGAGAAAATGAAAAAGGCTCTGAGAGCCGCCTAATCAAGTGAAATGGCTCTGGGAGCCGATAAGTAATGATCTGACCCCGGGGGTCG

Reverse complement sequence

CGACCCCCGGGGTCAGATCATTACTTATCGGCTCCCAGAGCCATTTCACTTGATTAGGCGGCTCTCAGAGCCTTTTTCATTTTCTCGGACTCCCAGAGTC[C/T]
AGCTGCCCAGCAGCATAACAATCTGTTTCCACTCGGGAAGCCTAATTTATGATGCCCGTAGACATCCCGAATCACACAGATTCGTTTCTGACCACTCAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.50% 20.00% 0.49% 0.04% NA
All Indica  2759 97.80% 2.10% 0.11% 0.00% NA
All Japonica  1512 52.40% 46.40% 0.99% 0.13% NA
Aus  269 48.00% 51.70% 0.37% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.40% 2.20% 0.43% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 95.50% 4.30% 0.13% 0.00% NA
Temperate Japonica  767 91.90% 7.70% 0.39% 0.00% NA
Tropical Japonica  504 4.80% 93.50% 1.39% 0.40% NA
Japonica Intermediate  241 26.60% 71.40% 2.07% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 65.60% 30.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424824884 G -> DEL N N silent_mutation Average:24.683; most accessible tissue: Zhenshan97 flower, score: 36.732 N N N N
vg0424824884 G -> A LOC_Os04g41880.1 upstream_gene_variant ; 1591.0bp to feature; MODIFIER silent_mutation Average:24.683; most accessible tissue: Zhenshan97 flower, score: 36.732 N N N N
vg0424824884 G -> A LOC_Os04g41890.1 downstream_gene_variant ; 646.0bp to feature; MODIFIER silent_mutation Average:24.683; most accessible tissue: Zhenshan97 flower, score: 36.732 N N N N
vg0424824884 G -> A LOC_Os04g41880-LOC_Os04g41890 intergenic_region ; MODIFIER silent_mutation Average:24.683; most accessible tissue: Zhenshan97 flower, score: 36.732 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0424824884 NA 2.19E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 9.25E-16 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 3.19E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 6.76E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 3.26E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 3.75E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 4.24E-11 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 4.50E-11 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 1.09E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 8.10E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 1.15E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 8.55E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 8.19E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 5.69E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 3.64E-13 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 8.90E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 1.74E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 1.76E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 6.05E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 5.47E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 4.64E-18 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 1.75E-13 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 1.46E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 2.37E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 1.49E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 2.35E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 3.39E-11 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 1.47E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424824884 NA 1.33E-11 mr1966_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251