Variant ID: vg0424638529 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 24638529 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TACACAAGTTACTTTTGAATGATTATATCATAATCGACGAAAATTGTATGCTTATATTATCGACAGTGGCAGATCGGGTTGGTTGGCTACTAATGACTTC[G/A]
TGCCTGTTTAGATGTCACCCTAAAATTTTTGCACCATATCACATCGAATGTTTAAACACCTACTTGAAGTATTAAATATAAGTTAAAAAAATAAGAATTG
CAATTCTTATTTTTTTAACTTATATTTAATACTTCAAGTAGGTGTTTAAACATTCGATGTGATATGGTGCAAAAATTTTAGGGTGACATCTAAACAGGCA[C/T]
GAAGTCATTAGTAGCCAACCAACCCGATCTGCCACTGTCGATAATATAAGCATACAATTTTCGTCGATTATGATATAATCATTCAAAAGTAACTTGTGTA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.60% | 6.10% | 0.28% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 81.10% | 18.10% | 0.86% | 0.00% | NA |
Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 84.40% | 15.10% | 0.52% | 0.00% | NA |
Tropical Japonica | 504 | 77.20% | 22.00% | 0.79% | 0.00% | NA |
Japonica Intermediate | 241 | 78.80% | 19.10% | 2.07% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0424638529 | G -> A | LOC_Os04g41540.1 | upstream_gene_variant ; 1853.0bp to feature; MODIFIER | silent_mutation | Average:56.673; most accessible tissue: Callus, score: 74.584 | N | N | N | N |
vg0424638529 | G -> A | LOC_Os04g41530.1 | downstream_gene_variant ; 2689.0bp to feature; MODIFIER | silent_mutation | Average:56.673; most accessible tissue: Callus, score: 74.584 | N | N | N | N |
vg0424638529 | G -> A | LOC_Os04g41530-LOC_Os04g41540 | intergenic_region ; MODIFIER | silent_mutation | Average:56.673; most accessible tissue: Callus, score: 74.584 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0424638529 | 3.69E-06 | NA | mr1085 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0424638529 | NA | 6.68E-06 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0424638529 | 1.33E-06 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0424638529 | 2.07E-06 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0424638529 | 3.24E-06 | NA | mr1437 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0424638529 | 7.01E-06 | NA | mr1878 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0424638529 | 8.40E-07 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0424638529 | 3.99E-06 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0424638529 | 3.48E-08 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0424638529 | 2.39E-06 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0424638529 | 2.06E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |