\
| Variant ID: vg0424423524 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 24423524 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATATAAAAATACTTATGTCATGCTTAAAGAACATTTGATGATAAATCAAGTCACAATAAAATAAATTATAATTACATAAATTTTTTGAATAAGACGAAA[G/T]
GTCAAACGTTTGTCAAAAAGTCAACGGCGTAATACATTAAAATACGAAATACGGAGGGAGTACTGTTTATAATAGGTGAATGAATTGAAACAAGGGGTTT
AAACCCCTTGTTTCAATTCATTCACCTATTATAAACAGTACTCCCTCCGTATTTCGTATTTTAATGTATTACGCCGTTGACTTTTTGACAAACGTTTGAC[C/A]
TTTCGTCTTATTCAAAAAATTTATGTAATTATAATTTATTTTATTGTGACTTGATTTATCATCAAATGTTCTTTAAGCATGACATAAGTATTTTTATATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0424423524 | G -> T | LOC_Os04g41180.1 | upstream_gene_variant ; 262.0bp to feature; MODIFIER | silent_mutation | Average:60.86; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0424423524 | G -> T | LOC_Os04g41189.1 | upstream_gene_variant ; 3580.0bp to feature; MODIFIER | silent_mutation | Average:60.86; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0424423524 | G -> T | LOC_Os04g41170.1 | downstream_gene_variant ; 1614.0bp to feature; MODIFIER | silent_mutation | Average:60.86; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0424423524 | G -> T | LOC_Os04g41170-LOC_Os04g41180 | intergenic_region ; MODIFIER | silent_mutation | Average:60.86; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0424423524 | 3.22E-06 | 2.14E-09 | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424423524 | NA | 3.63E-08 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424423524 | NA | 9.17E-07 | mr1203 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424423524 | NA | 1.14E-06 | mr1613 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424423524 | NA | 1.63E-07 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424423524 | 9.18E-08 | 2.61E-12 | mr1071_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424423524 | 1.83E-06 | 2.31E-10 | mr1080_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424423524 | 4.58E-07 | 5.93E-09 | mr1100_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424423524 | 7.26E-08 | 5.82E-10 | mr1203_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424423524 | 1.95E-08 | 8.90E-12 | mr1613_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424423524 | NA | 9.58E-08 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424423524 | NA | 5.12E-06 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |