\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424423524:

Variant ID: vg0424423524 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 24423524
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATATAAAAATACTTATGTCATGCTTAAAGAACATTTGATGATAAATCAAGTCACAATAAAATAAATTATAATTACATAAATTTTTTGAATAAGACGAAA[G/T]
GTCAAACGTTTGTCAAAAAGTCAACGGCGTAATACATTAAAATACGAAATACGGAGGGAGTACTGTTTATAATAGGTGAATGAATTGAAACAAGGGGTTT

Reverse complement sequence

AAACCCCTTGTTTCAATTCATTCACCTATTATAAACAGTACTCCCTCCGTATTTCGTATTTTAATGTATTACGCCGTTGACTTTTTGACAAACGTTTGAC[C/A]
TTTCGTCTTATTCAAAAAATTTATGTAATTATAATTTATTTTATTGTGACTTGATTTATCATCAAATGTTCTTTAAGCATGACATAAGTATTTTTATATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.70% 4.30% 0.00% 0.00% NA
All Indica  2759 95.60% 4.40% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 92.30% 7.70% 0.00% 0.00% NA
Indica Intermediate  786 94.40% 5.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424423524 G -> T LOC_Os04g41180.1 upstream_gene_variant ; 262.0bp to feature; MODIFIER silent_mutation Average:60.86; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0424423524 G -> T LOC_Os04g41189.1 upstream_gene_variant ; 3580.0bp to feature; MODIFIER silent_mutation Average:60.86; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0424423524 G -> T LOC_Os04g41170.1 downstream_gene_variant ; 1614.0bp to feature; MODIFIER silent_mutation Average:60.86; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0424423524 G -> T LOC_Os04g41170-LOC_Os04g41180 intergenic_region ; MODIFIER silent_mutation Average:60.86; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0424423524 3.22E-06 2.14E-09 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424423524 NA 3.63E-08 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424423524 NA 9.17E-07 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424423524 NA 1.14E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424423524 NA 1.63E-07 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424423524 9.18E-08 2.61E-12 mr1071_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424423524 1.83E-06 2.31E-10 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424423524 4.58E-07 5.93E-09 mr1100_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424423524 7.26E-08 5.82E-10 mr1203_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424423524 1.95E-08 8.90E-12 mr1613_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424423524 NA 9.58E-08 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424423524 NA 5.12E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251