Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424185662:

Variant ID: vg0424185662 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 24185662
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, A: 0.07, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCCATTAGTCATATTTCAACTTATAATTATGTAAGAACATGGGAATCAGTACCTATCTCTTGGTTTAAAATTGAAAAAAAATCATGCCAGATATGTAT[T/A]
GCTTATGAAGCTACTGCTTATATACGAATTGTGCAAATGCCTTGTGCCAAGAGAAGATACTCAAAACAGTCACAAGAAATAGACTGACAAAATTAGTCTT

Reverse complement sequence

AAGACTAATTTTGTCAGTCTATTTCTTGTGACTGTTTTGAGTATCTTCTCTTGGCACAAGGCATTTGCACAATTCGTATATAAGCAGTAGCTTCATAAGC[A/T]
ATACATATCTGGCATGATTTTTTTTCAATTTTAAACCAAGAGATAGGTACTGATTCCCATGTTCTTACATAATTATAAGTTGAAATATGACTAATGGAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.90%	4.10%	0.00%	0.00%	NA
All Indica	2759	94.10%	5.90%	0.00%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	88.80%	11.20%	0.00%	0.00%	NA
Indica I	595	90.80%	9.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	93.20%	6.80%	0.00%	0.00%	NA
Indica Intermediate	786	94.40%	5.60%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0424185662	T -> A	LOC_Os04g40750.1	upstream_gene_variant ; 2257.0bp to feature; MODIFIER	silent_mutation	Average:38.266; most accessible tissue: Callus, score: 67.852	N	N	N	N
vg0424185662	T -> A	LOC_Os04g40760.1	upstream_gene_variant ; 3772.0bp to feature; MODIFIER	silent_mutation	Average:38.266; most accessible tissue: Callus, score: 67.852	N	N	N	N
vg0424185662	T -> A	LOC_Os04g40740.3	upstream_gene_variant ; 592.0bp to feature; MODIFIER	silent_mutation	Average:38.266; most accessible tissue: Callus, score: 67.852	N	N	N	N
vg0424185662	T -> A	LOC_Os04g40740.4	upstream_gene_variant ; 592.0bp to feature; MODIFIER	silent_mutation	Average:38.266; most accessible tissue: Callus, score: 67.852	N	N	N	N
vg0424185662	T -> A	LOC_Os04g40740.1	intron_variant ; MODIFIER	silent_mutation	Average:38.266; most accessible tissue: Callus, score: 67.852	N	N	N	N
vg0424185662	T -> A	LOC_Os04g40740.2	intron_variant ; MODIFIER	silent_mutation	Average:38.266; most accessible tissue: Callus, score: 67.852	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0424185662	NA	7.18E-06	mr1184_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	9.57E-06	2.80E-06	mr1245_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	NA	9.77E-06	mr1278_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	2.97E-06	2.97E-06	mr1311_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	1.23E-06	1.23E-06	mr1312_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	5.28E-07	5.28E-07	mr1329_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	1.83E-07	1.83E-07	mr1337_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	8.07E-07	1.03E-07	mr1373_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	1.07E-06	1.07E-06	mr1524_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	NA	7.16E-07	mr1648_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	NA	2.98E-06	mr1660_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	3.25E-07	3.25E-07	mr1663_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	NA	4.59E-06	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	6.41E-06	6.41E-06	mr1688_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	7.99E-07	NA	mr1754_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	NA	6.44E-06	mr1768_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	3.66E-06	3.66E-06	mr1812_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	5.55E-06	5.55E-06	mr1832_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662	5.99E-06	5.99E-06	mr1833_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251