\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424185662:

Variant ID: vg0424185662 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 24185662
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, A: 0.07, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCCATTAGTCATATTTCAACTTATAATTATGTAAGAACATGGGAATCAGTACCTATCTCTTGGTTTAAAATTGAAAAAAAATCATGCCAGATATGTAT[T/A]
GCTTATGAAGCTACTGCTTATATACGAATTGTGCAAATGCCTTGTGCCAAGAGAAGATACTCAAAACAGTCACAAGAAATAGACTGACAAAATTAGTCTT

Reverse complement sequence

AAGACTAATTTTGTCAGTCTATTTCTTGTGACTGTTTTGAGTATCTTCTCTTGGCACAAGGCATTTGCACAATTCGTATATAAGCAGTAGCTTCATAAGC[A/T]
ATACATATCTGGCATGATTTTTTTTCAATTTTAAACCAAGAGATAGGTACTGATTCCCATGTTCTTACATAATTATAAGTTGAAATATGACTAATGGAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.90% 4.10% 0.00% 0.00% NA
All Indica  2759 94.10% 5.90% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 90.80% 9.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 93.20% 6.80% 0.00% 0.00% NA
Indica Intermediate  786 94.40% 5.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424185662 T -> A LOC_Os04g40750.1 upstream_gene_variant ; 2257.0bp to feature; MODIFIER silent_mutation Average:38.266; most accessible tissue: Callus, score: 67.852 N N N N
vg0424185662 T -> A LOC_Os04g40760.1 upstream_gene_variant ; 3772.0bp to feature; MODIFIER silent_mutation Average:38.266; most accessible tissue: Callus, score: 67.852 N N N N
vg0424185662 T -> A LOC_Os04g40740.3 upstream_gene_variant ; 592.0bp to feature; MODIFIER silent_mutation Average:38.266; most accessible tissue: Callus, score: 67.852 N N N N
vg0424185662 T -> A LOC_Os04g40740.4 upstream_gene_variant ; 592.0bp to feature; MODIFIER silent_mutation Average:38.266; most accessible tissue: Callus, score: 67.852 N N N N
vg0424185662 T -> A LOC_Os04g40740.1 intron_variant ; MODIFIER silent_mutation Average:38.266; most accessible tissue: Callus, score: 67.852 N N N N
vg0424185662 T -> A LOC_Os04g40740.2 intron_variant ; MODIFIER silent_mutation Average:38.266; most accessible tissue: Callus, score: 67.852 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0424185662 NA 7.18E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 9.57E-06 2.80E-06 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 NA 9.77E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 2.97E-06 2.97E-06 mr1311_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 1.23E-06 1.23E-06 mr1312_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 5.28E-07 5.28E-07 mr1329_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 1.83E-07 1.83E-07 mr1337_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 8.07E-07 1.03E-07 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 1.07E-06 1.07E-06 mr1524_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 NA 7.16E-07 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 NA 2.98E-06 mr1660_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 3.25E-07 3.25E-07 mr1663_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 NA 4.59E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 6.41E-06 6.41E-06 mr1688_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 7.99E-07 NA mr1754_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 NA 6.44E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 3.66E-06 3.66E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 5.55E-06 5.55E-06 mr1832_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424185662 5.99E-06 5.99E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251