Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0424181194:

Variant ID: vg0424181194 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 24181194
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, T: 0.07, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


GAACTAGTGGAAGCACTAGCCTCTTCCTCAGCTTTCTGTTCAGCCTCGAGCACAGCCAGCTGAAGAGGGCGTGTAAGAGTCAGTTAATATGTACCAAGTC[A/T]
GAAATACCGTTTTGTCTCAAAGGGGACACAACATGACAATTTTACCTCGTCGAGTATGGGTTTCAGTTCCTTATATCGAGTTTCGGCAAGATCAAAACCA

Reverse complement sequence

TGGTTTTGATCTTGCCGAAACTCGATATAAGGAACTGAAACCCATACTCGACGAGGTAAAATTGTCATGTTGTGTCCCCTTTGAGACAAAACGGTATTTC[T/A]
GACTTGGTACATATTAACTGACTCTTACACGCCCTCTTCAGCTGGCTGTGCTCGAGGCTGAACAGAAAGCTGAGGAAGAGGCTAGTGCTTCCACTAGTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.90% 4.10% 0.00% 0.00% NA
All Indica  2759 94.20% 5.80% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 90.40% 9.60% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 93.60% 6.40% 0.00% 0.00% NA
Indica Intermediate  786 94.50% 5.50% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424181194 A -> T LOC_Os04g40730.1 upstream_gene_variant ; 2218.0bp to feature; MODIFIER silent_mutation Average:75.553; most accessible tissue: Callus, score: 92.758 N N N N
vg0424181194 A -> T LOC_Os04g40740.1 intron_variant ; MODIFIER silent_mutation Average:75.553; most accessible tissue: Callus, score: 92.758 N N N N
vg0424181194 A -> T LOC_Os04g40740.3 intron_variant ; MODIFIER silent_mutation Average:75.553; most accessible tissue: Callus, score: 92.758 N N N N
vg0424181194 A -> T LOC_Os04g40740.2 intron_variant ; MODIFIER silent_mutation Average:75.553; most accessible tissue: Callus, score: 92.758 N N N N
vg0424181194 A -> T LOC_Os04g40740.4 intron_variant ; MODIFIER silent_mutation Average:75.553; most accessible tissue: Callus, score: 92.758 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0424181194 A T -0.02 -0.01 -0.02 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0424181194 4.03E-06 4.03E-06 mr1049_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 9.68E-06 9.68E-06 mr1066_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 NA 1.42E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 1.33E-06 3.43E-07 mr1245_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 NA 1.70E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 6.11E-06 6.11E-06 mr1286_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 8.35E-06 NA mr1295_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 4.13E-07 4.13E-07 mr1311_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 8.01E-08 8.00E-08 mr1312_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 7.59E-08 7.59E-08 mr1329_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 4.41E-08 4.41E-08 mr1337_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 7.37E-08 8.06E-09 mr1373_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 2.34E-06 2.34E-06 mr1374_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 9.65E-08 9.65E-08 mr1524_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 1.36E-06 6.91E-08 mr1648_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 6.13E-06 6.13E-06 mr1652_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 4.32E-06 6.96E-07 mr1660_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 2.85E-08 2.85E-08 mr1663_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 1.23E-06 1.23E-06 mr1665_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 1.87E-06 1.87E-06 mr1674_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 NA 7.21E-07 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 2.15E-06 2.15E-06 mr1687_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 5.71E-07 5.71E-07 mr1688_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 2.26E-06 2.26E-06 mr1697_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 1.18E-06 NA mr1754_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 NA 9.50E-06 mr1757_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 NA 6.79E-06 mr1766_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 5.87E-06 3.22E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 4.65E-07 4.65E-07 mr1812_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 3.41E-06 3.41E-06 mr1822_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 7.63E-07 7.62E-07 mr1832_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 8.42E-07 8.41E-07 mr1833_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 1.63E-06 1.63E-06 mr1843_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 1.57E-06 1.57E-06 mr1847_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 5.49E-06 5.49E-06 mr1965_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 8.48E-06 8.48E-06 mr1979_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424181194 1.61E-06 1.61E-06 mr1981_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251