Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0424149847:

Variant ID: vg0424149847 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 24149847
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAGCCAATTTAATAGTCAATTCATATAATAGTAACTTAATATAGTACTAATATATGGTCCCACCTGTCATACACACATTGTGTCTTGGAGTCCGCGTTA[T/C]
AGTTGGCTACAAATTTATAGCCCGCTGCTTTTTTCTCCCTTCTTTTATCTCATAAAAATATGTTTATAGCTGGCTAATAGTATGCTATTGTACATGTTCT

Reverse complement sequence

AGAACATGTACAATAGCATACTATTAGCCAGCTATAAACATATTTTTATGAGATAAAAGAAGGGAGAAAAAAGCAGCGGGCTATAAATTTGTAGCCAACT[A/G]
TAACGCGGACTCCAAGACACAATGTGTGTATGACAGGTGGGACCATATATTAGTACTATATTAAGTTACTATTATATGAATTGACTATTAAATTGGCTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 9.40% 2.67% 0.00% NA
All Indica  2759 99.60% 0.30% 0.11% 0.00% NA
All Japonica  1512 65.10% 27.60% 7.34% 0.00% NA
Aus  269 96.70% 0.40% 2.97% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.50% 0.13% 0.00% NA
Temperate Japonica  767 48.00% 41.60% 10.43% 0.00% NA
Tropical Japonica  504 84.10% 11.70% 4.17% 0.00% NA
Japonica Intermediate  241 79.70% 16.20% 4.15% 0.00% NA
VI/Aromatic  96 86.50% 12.50% 1.04% 0.00% NA
Intermediate  90 86.70% 10.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424149847 T -> C LOC_Os04g40690.1 upstream_gene_variant ; 1205.0bp to feature; MODIFIER silent_mutation Average:67.679; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N
vg0424149847 T -> C LOC_Os04g40680.1 downstream_gene_variant ; 1836.0bp to feature; MODIFIER silent_mutation Average:67.679; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N
vg0424149847 T -> C LOC_Os04g40680.2 downstream_gene_variant ; 1836.0bp to feature; MODIFIER silent_mutation Average:67.679; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N
vg0424149847 T -> C LOC_Os04g40680-LOC_Os04g40690 intergenic_region ; MODIFIER silent_mutation Average:67.679; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0424149847 NA 2.23E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0424149847 NA 9.42E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0424149847 NA 9.84E-09 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 8.66E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 1.74E-06 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 4.72E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 6.86E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 9.69E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 1.12E-06 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 3.45E-06 1.79E-10 mr1252_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 2.66E-07 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 1.51E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 9.18E-07 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 3.33E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 9.98E-06 mr1555_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 1.84E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 3.10E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 7.56E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 8.46E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 1.57E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 4.75E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 4.11E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 7.14E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 6.13E-06 6.13E-06 mr1889_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 2.05E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847 NA 9.50E-15 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251