Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424149847:

Variant ID: vg0424149847 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 24149847
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAGCCAATTTAATAGTCAATTCATATAATAGTAACTTAATATAGTACTAATATATGGTCCCACCTGTCATACACACATTGTGTCTTGGAGTCCGCGTTA[T/C]
AGTTGGCTACAAATTTATAGCCCGCTGCTTTTTTCTCCCTTCTTTTATCTCATAAAAATATGTTTATAGCTGGCTAATAGTATGCTATTGTACATGTTCT

Reverse complement sequence

AGAACATGTACAATAGCATACTATTAGCCAGCTATAAACATATTTTTATGAGATAAAAGAAGGGAGAAAAAAGCAGCGGGCTATAAATTTGTAGCCAACT[A/G]
TAACGCGGACTCCAAGACACAATGTGTGTATGACAGGTGGGACCATATATTAGTACTATATTAAGTTACTATTATATGAATTGACTATTAAATTGGCTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.90%	9.40%	2.67%	0.00%	NA
All Indica	2759	99.60%	0.30%	0.11%	0.00%	NA
All Japonica	1512	65.10%	27.60%	7.34%	0.00%	NA
Aus	269	96.70%	0.40%	2.97%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.50%	0.13%	0.00%	NA
Temperate Japonica	767	48.00%	41.60%	10.43%	0.00%	NA
Tropical Japonica	504	84.10%	11.70%	4.17%	0.00%	NA
Japonica Intermediate	241	79.70%	16.20%	4.15%	0.00%	NA
VI/Aromatic	96	86.50%	12.50%	1.04%	0.00%	NA
Intermediate	90	86.70%	10.00%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0424149847	T -> C	LOC_Os04g40690.1	upstream_gene_variant ; 1205.0bp to feature; MODIFIER	silent_mutation	Average:67.679; most accessible tissue: Minghui63 panicle, score: 88.281	N	N	N	N
vg0424149847	T -> C	LOC_Os04g40680.1	downstream_gene_variant ; 1836.0bp to feature; MODIFIER	silent_mutation	Average:67.679; most accessible tissue: Minghui63 panicle, score: 88.281	N	N	N	N
vg0424149847	T -> C	LOC_Os04g40680.2	downstream_gene_variant ; 1836.0bp to feature; MODIFIER	silent_mutation	Average:67.679; most accessible tissue: Minghui63 panicle, score: 88.281	N	N	N	N
vg0424149847	T -> C	LOC_Os04g40680-LOC_Os04g40690	intergenic_region ; MODIFIER	silent_mutation	Average:67.679; most accessible tissue: Minghui63 panicle, score: 88.281	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0424149847	NA	2.23E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0424149847	NA	9.42E-11	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0424149847	NA	9.84E-09	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	8.66E-06	mr1045_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	1.74E-06	mr1204_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	4.72E-06	mr1204_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	6.86E-07	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	9.69E-08	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	1.12E-06	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	3.45E-06	1.79E-10	mr1252_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	2.66E-07	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	1.51E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	9.18E-07	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	3.33E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	9.98E-06	mr1555_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	1.84E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	3.10E-07	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	7.56E-06	mr1729_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	8.46E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	1.57E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	4.75E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	4.11E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	7.14E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	6.13E-06	6.13E-06	mr1889_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	2.05E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424149847	NA	9.50E-15	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251