\
| Variant ID: vg0424121172 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 24121172 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 277. )
AGTGAAAGACCAAAATAATGCAGCCATCGTACAGATCAATGAGACCTTAACTTTGCAATCATCCATCAATTGAACGAAAAATTGAAATCTACAACCATTG[G/A]
CAAGTGATTTACCATAACAAGGAGCAGATGCTCCAAGAACTCGGCGAGTCGGAGCCATCCCAAAGCTTGAGGCAATCACGTCGACAATAGCAGTTTGTGG
CCACAAACTGCTATTGTCGACGTGATTGCCTCAAGCTTTGGGATGGCTCCGACTCGCCGAGTTCTTGGAGCATCTGCTCCTTGTTATGGTAAATCACTTG[C/T]
CAATGGTTGTAGATTTCAATTTTTCGTTCAATTGATGGATGATTGCAAAGTTAAGGTCTCATTGATCTGTACGATGGCTGCATTATTTTGGTCTTTCACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 93.20% | 6.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0424121172 | G -> A | LOC_Os04g40630.1 | downstream_gene_variant ; 2956.0bp to feature; MODIFIER | silent_mutation | Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| vg0424121172 | G -> A | LOC_Os04g40640.1 | downstream_gene_variant ; 4311.0bp to feature; MODIFIER | silent_mutation | Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| vg0424121172 | G -> A | LOC_Os04g40630.3 | downstream_gene_variant ; 2956.0bp to feature; MODIFIER | silent_mutation | Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| vg0424121172 | G -> A | LOC_Os04g40630.4 | downstream_gene_variant ; 2956.0bp to feature; MODIFIER | silent_mutation | Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| vg0424121172 | G -> A | LOC_Os04g40630.2 | downstream_gene_variant ; 2956.0bp to feature; MODIFIER | silent_mutation | Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| vg0424121172 | G -> A | LOC_Os04g40630-LOC_Os04g40640 | intergenic_region ; MODIFIER | silent_mutation | Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0424121172 | NA | 9.06E-06 | mr1015_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424121172 | NA | 6.94E-06 | mr1181_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424121172 | 3.29E-06 | 1.88E-06 | mr1373_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424121172 | 7.90E-06 | 2.31E-06 | mr1648_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424121172 | NA | 6.56E-06 | mr1660_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424121172 | 6.22E-07 | 6.22E-07 | mr1663_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424121172 | NA | 1.69E-07 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424121172 | 1.24E-07 | 5.91E-09 | mr1708_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0424121172 | NA | 8.30E-06 | mr1768_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |