\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424121172:

Variant ID: vg0424121172 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 24121172
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGAAAGACCAAAATAATGCAGCCATCGTACAGATCAATGAGACCTTAACTTTGCAATCATCCATCAATTGAACGAAAAATTGAAATCTACAACCATTG[G/A]
CAAGTGATTTACCATAACAAGGAGCAGATGCTCCAAGAACTCGGCGAGTCGGAGCCATCCCAAAGCTTGAGGCAATCACGTCGACAATAGCAGTTTGTGG

Reverse complement sequence

CCACAAACTGCTATTGTCGACGTGATTGCCTCAAGCTTTGGGATGGCTCCGACTCGCCGAGTTCTTGGAGCATCTGCTCCTTGTTATGGTAAATCACTTG[C/T]
CAATGGTTGTAGATTTCAATTTTTCGTTCAATTGATGGATGATTGCAAAGTTAAGGTCTCATTGATCTGTACGATGGCTGCATTATTTTGGTCTTTCACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.30% 4.70% 0.00% 0.00% NA
All Indica  2759 93.20% 6.80% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 88.50% 11.50% 0.00% 0.00% NA
Indica I  595 90.90% 9.10% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 90.50% 9.50% 0.00% 0.00% NA
Indica Intermediate  786 94.50% 5.50% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424121172 G -> A LOC_Os04g40630.1 downstream_gene_variant ; 2956.0bp to feature; MODIFIER silent_mutation Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0424121172 G -> A LOC_Os04g40640.1 downstream_gene_variant ; 4311.0bp to feature; MODIFIER silent_mutation Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0424121172 G -> A LOC_Os04g40630.3 downstream_gene_variant ; 2956.0bp to feature; MODIFIER silent_mutation Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0424121172 G -> A LOC_Os04g40630.4 downstream_gene_variant ; 2956.0bp to feature; MODIFIER silent_mutation Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0424121172 G -> A LOC_Os04g40630.2 downstream_gene_variant ; 2956.0bp to feature; MODIFIER silent_mutation Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0424121172 G -> A LOC_Os04g40630-LOC_Os04g40640 intergenic_region ; MODIFIER silent_mutation Average:57.693; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0424121172 NA 9.06E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172 NA 6.94E-06 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172 3.29E-06 1.88E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172 7.90E-06 2.31E-06 mr1648_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172 NA 6.56E-06 mr1660_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172 6.22E-07 6.22E-07 mr1663_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172 NA 1.69E-07 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172 1.24E-07 5.91E-09 mr1708_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424121172 NA 8.30E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251