Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424114621:

Variant ID: vg0424114621 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 24114621
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTTCTTCAAACTTTCAACTTTTTTATCACATCAAAACTTTCCTACACACGTAAACTTTTAACTTTTCTGTCATATCGTTTGAATTTCAACTAAACTTT[T/C]
AATTTTAACGTGAACTAAACACACCCATGATATCTCGCCGTCGCCTTGGCTTTGGAAGAGAGCGTACGTAAAGCTTCCAGTGAATCTAGCCATCACTGAT

Reverse complement sequence

ATCAGTGATGGCTAGATTCACTGGAAGCTTTACGTACGCTCTCTTCCAAAGCCAAGGCGACGGCGAGATATCATGGGTGTGTTTAGTTCACGTTAAAATT[A/G]
AAAGTTTAGTTGAAATTCAAACGATATGACAGAAAAGTTAAAAGTTTACGTGTGTAGGAAAGTTTTGATGTGATAAAAAAGTTGAAAGTTTGAAGAACAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 6.70% 0.00% 0.00% NA
All Indica  2759 90.10% 9.90% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 86.60% 13.40% 0.00% 0.00% NA
Indica I  595 91.10% 8.90% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 83.40% 16.60% 0.00% 0.00% NA
Indica Intermediate  786 92.20% 7.80% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0424114621 T -> C LOC_Os04g40620.1 upstream_gene_variant ; 4863.0bp to feature; MODIFIER silent_mutation Average:90.28; most accessible tissue: Minghui63 root, score: 96.896 N N N N
vg0424114621 T -> C LOC_Os04g40630.1 upstream_gene_variant ; 1342.0bp to feature; MODIFIER silent_mutation Average:90.28; most accessible tissue: Minghui63 root, score: 96.896 N N N N
vg0424114621 T -> C LOC_Os04g40630.3 upstream_gene_variant ; 1297.0bp to feature; MODIFIER silent_mutation Average:90.28; most accessible tissue: Minghui63 root, score: 96.896 N N N N
vg0424114621 T -> C LOC_Os04g40630.4 upstream_gene_variant ; 1340.0bp to feature; MODIFIER silent_mutation Average:90.28; most accessible tissue: Minghui63 root, score: 96.896 N N N N
vg0424114621 T -> C LOC_Os04g40630.2 upstream_gene_variant ; 1350.0bp to feature; MODIFIER silent_mutation Average:90.28; most accessible tissue: Minghui63 root, score: 96.896 N N N N
vg0424114621 T -> C LOC_Os04g40620-LOC_Os04g40630 intergenic_region ; MODIFIER silent_mutation Average:90.28; most accessible tissue: Minghui63 root, score: 96.896 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0424114621 T C -0.03 0.0 -0.01 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0424114621 8.03E-06 3.66E-07 mr1653 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424114621 NA 3.92E-06 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424114621 NA 8.49E-06 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424114621 NA 1.75E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424114621 NA 3.59E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424114621 NA 2.96E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424114621 3.39E-06 NA mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424114621 3.61E-07 8.36E-09 mr1708_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424114621 NA 8.50E-09 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424114621 NA 3.75E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424114621 NA 3.29E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251