Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424093683:

Variant ID: vg0424093683 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 24093683
Reference Allele: T	Alternative Allele: G,A
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, G: 0.35, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

ATTAAAAAGACAAGTCACGCATAAAATATTAATCATGTTTTATCATCTAACAACAATGAAAATACAAATTATAAAAAATTTTCATATAAGAGAAATCCAA[T/G,A]
GTTTGCTTTTTTTTTTAGGACGGAGGGAGTATAACATATTCTTCTCTACTGTTATTTGAACTGGCTTGGCTGCATCGTTCGGGACAAAACGGAAGTACTC

Reverse complement sequence

GAGTACTTCCGTTTTGTCCCGAACGATGCAGCCAAGCCAGTTCAAATAACAGTAGAGAAGAATATGTTATACTCCCTCCGTCCTAAAAAAAAAAGCAAAC[A/C,T]
TTGGATTTCTCTTATATGAAAATTTTTTATAATTTGTATTTTCATTGTTGTTAGATGATAAAACATGATTAATATTTTATGCGTGACTTGTCTTTTTAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.20%	6.00%	4.72%	46.97%	A: 0.06%
All Indica	2759	6.80%	9.70%	6.42%	76.95%	A: 0.11%
All Japonica	1512	99.70%	0.00%	0.00%	0.33%	NA
Aus	269	58.00%	4.10%	14.87%	23.05%	NA
Indica I	595	3.00%	18.70%	4.37%	73.95%	NA
Indica II	465	4.10%	7.30%	1.51%	87.10%	NA
Indica III	913	8.40%	4.30%	10.41%	76.67%	A: 0.22%
Indica Intermediate	786	9.40%	10.70%	6.23%	73.54%	A: 0.13%
Temperate Japonica	767	99.50%	0.00%	0.00%	0.52%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	55.60%	5.60%	6.67%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0424093683	T -> A	LOC_Os04g40570.1	upstream_gene_variant ; 298.0bp to feature; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Callus, score: 95.611	N	N	N	N
vg0424093683	T -> A	LOC_Os04g40580.1	downstream_gene_variant ; 4622.0bp to feature; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Callus, score: 95.611	N	N	N	N
vg0424093683	T -> A	LOC_Os04g40560-LOC_Os04g40570	intergenic_region ; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Callus, score: 95.611	N	N	N	N
vg0424093683	T -> DEL	N	N	silent_mutation	Average:63.652; most accessible tissue: Callus, score: 95.611	N	N	N	N
vg0424093683	T -> G	LOC_Os04g40570.1	upstream_gene_variant ; 298.0bp to feature; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Callus, score: 95.611	N	N	N	N
vg0424093683	T -> G	LOC_Os04g40580.1	downstream_gene_variant ; 4622.0bp to feature; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Callus, score: 95.611	N	N	N	N
vg0424093683	T -> G	LOC_Os04g40560-LOC_Os04g40570	intergenic_region ; MODIFIER	silent_mutation	Average:63.652; most accessible tissue: Callus, score: 95.611	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0424093683	NA	5.33E-48	mr1063	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	1.47E-50	mr1078	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	2.61E-53	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	2.49E-14	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	6.46E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	3.98E-10	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	5.86E-42	mr1509	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	4.22E-24	mr1551	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	3.03E-48	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	1.88E-23	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	1.54E-20	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	1.38E-58	mr1671	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	7.52E-41	mr1721	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	6.16E-11	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	1.26E-18	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	1.36E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	1.06E-11	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	1.15E-21	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	1.30E-62	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	1.50E-66	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	4.25E-61	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	2.38E-36	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	5.44E-55	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	9.79E-44	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	1.56E-57	mr1526_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	3.10E-57	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	6.77E-34	mr1571_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	9.47E-32	mr1580_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	6.41E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	3.11E-21	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	4.79E-49	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	3.51E-31	mr1825_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424093683	NA	3.18E-32	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251