Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0424075113:

Variant ID: vg0424075113 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 24075113
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATAAGACGAATGGTCGAACAAACATTTTAAAATGGAGGGAGAGTATATAATTTACAGATTCTCACTATTTGTGCAAAAGAACTATTTTGTGGGTGTTG[G/A]
AACTGAACTTGGAACAGAGGTGTTCGAGACAGAAACATCTCTGCGTAGCGCGTGGTGTTCTCTTCCATCCAAATTCCAAACTAACAACATTCTCAATGGA

Reverse complement sequence

TCCATTGAGAATGTTGTTAGTTTGGAATTTGGATGGAAGAGAACACCACGCGCTACGCAGAGATGTTTCTGTCTCGAACACCTCTGTTCCAAGTTCAGTT[C/T]
CAACACCCACAAAATAGTTCTTTTGCACAAATAGTGAGAATCTGTAAATTATATACTCTCCCTCCATTTTAAAATGTTTGTTCGACCATTCGTCTTATTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	30.20%	1.65%	0.00%	NA
All Indica	2759	97.00%	2.80%	0.18%	0.00%	NA
All Japonica	1512	24.20%	71.40%	4.37%	0.00%	NA
Aus	269	42.80%	55.40%	1.86%	0.00%	NA
Indica I	595	98.30%	1.50%	0.17%	0.00%	NA
Indica II	465	97.40%	2.40%	0.22%	0.00%	NA
Indica III	913	98.00%	2.00%	0.00%	0.00%	NA
Indica Intermediate	786	94.50%	5.10%	0.38%	0.00%	NA
Temperate Japonica	767	43.00%	49.90%	7.04%	0.00%	NA
Tropical Japonica	504	1.00%	98.20%	0.79%	0.00%	NA
Japonica Intermediate	241	12.90%	83.80%	3.32%	0.00%	NA
VI/Aromatic	96	15.60%	83.30%	1.04%	0.00%	NA
Intermediate	90	56.70%	42.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0424075113	G -> A	LOC_Os04g40520.1	upstream_gene_variant ; 2989.0bp to feature; MODIFIER	silent_mutation	Average:66.664; most accessible tissue: Minghui63 flower, score: 80.815	N	N	N	N
vg0424075113	G -> A	LOC_Os04g40530.1	downstream_gene_variant ; 384.0bp to feature; MODIFIER	silent_mutation	Average:66.664; most accessible tissue: Minghui63 flower, score: 80.815	N	N	N	N
vg0424075113	G -> A	LOC_Os04g40540.1	downstream_gene_variant ; 98.0bp to feature; MODIFIER	silent_mutation	Average:66.664; most accessible tissue: Minghui63 flower, score: 80.815	N	N	N	N
vg0424075113	G -> A	LOC_Os04g40550.1	downstream_gene_variant ; 2696.0bp to feature; MODIFIER	silent_mutation	Average:66.664; most accessible tissue: Minghui63 flower, score: 80.815	N	N	N	N
vg0424075113	G -> A	LOC_Os04g40540.2	downstream_gene_variant ; 98.0bp to feature; MODIFIER	silent_mutation	Average:66.664; most accessible tissue: Minghui63 flower, score: 80.815	N	N	N	N
vg0424075113	G -> A	LOC_Os04g40540.3	downstream_gene_variant ; 98.0bp to feature; MODIFIER	silent_mutation	Average:66.664; most accessible tissue: Minghui63 flower, score: 80.815	N	N	N	N
vg0424075113	G -> A	LOC_Os04g40530-LOC_Os04g40540	intergenic_region ; MODIFIER	silent_mutation	Average:66.664; most accessible tissue: Minghui63 flower, score: 80.815	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0424075113	NA	4.11E-12	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0424075113	NA	5.96E-15	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	1.75E-12	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	9.27E-06	mr1398	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	6.61E-09	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	8.78E-10	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	4.12E-11	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	5.00E-15	mr1819	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	3.98E-15	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	2.55E-08	mr1045_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	3.87E-06	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	1.06E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	1.59E-08	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	1.54E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	8.93E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	7.83E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	2.38E-36	mr1580_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	8.44E-08	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	2.30E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	7.96E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	6.79E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	2.74E-34	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0424075113	NA	4.65E-11	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251