Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423976382:

Variant ID: vg0423976382 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 23976382
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

CGATTGAGATGATGTTTGCACTCTTCTTCTAACATGGCACCGGCTGCAAGGTTCCAGAACAGTCAAATTAACTGTAGATGGAACTTTATCCTCAATGTAT[G/A]
TTCTGATAGCCGCGAGCCCCCTTGGAGCTTCCGTGAGAACACCATCTATCATGGGAAAACACCGCCTATACTTATCTTGATCACACCTAGGACCATAAAT

Reverse complement sequence

ATTTATGGTCCTAGGTGTGATCAAGATAAGTATAGGCGGTGTTTTCCCATGATAGATGGTGTTCTCACGGAAGCTCCAAGGGGGCTCGCGGCTATCAGAA[C/T]
ATACATTGAGGATAAAGTTCCATCTACAGTTAATTTGACTGTTCTGGAACCTTGCAGCCGGTGCCATGTTAGAAGAAGAGTGCAAACATCATCTCAATCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.10%	4.20%	0.97%	28.69%	NA
All Indica	2759	42.80%	7.20%	1.63%	48.35%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.07%	NA
Aus	269	96.70%	0.40%	0.00%	2.97%	NA
Indica I	595	8.70%	18.50%	4.54%	68.24%	NA
Indica II	465	81.70%	2.60%	0.86%	14.84%	NA
Indica III	913	42.70%	1.50%	0.11%	55.64%	NA
Indica Intermediate	786	45.80%	7.90%	1.65%	44.66%	NA
Temperate Japonica	767	99.70%	0.00%	0.13%	0.13%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	1.10%	0.00%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0423976382	G -> DEL	N	N	silent_mutation	Average:63.22; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0423976382	G -> A	LOC_Os04g40330.1	3_prime_UTR_variant ; 1053.0bp to feature; MODIFIER	silent_mutation	Average:63.22; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0423976382	G -> A	LOC_Os04g40330.2	3_prime_UTR_variant ; 1053.0bp to feature; MODIFIER	silent_mutation	Average:63.22; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0423976382	G -> A	LOC_Os04g40330.3	3_prime_UTR_variant ; 1053.0bp to feature; MODIFIER	silent_mutation	Average:63.22; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0423976382	G -> A	LOC_Os04g40320.1	upstream_gene_variant ; 4155.0bp to feature; MODIFIER	silent_mutation	Average:63.22; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0423976382	NA	2.57E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	2.56E-07	mr1030	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	7.00E-08	mr1035	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	3.86E-11	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	1.56E-09	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	6.61E-06	mr1057	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	4.08E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	6.95E-12	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	9.39E-09	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	1.08E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	7.26E-06	mr1333	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	2.89E-07	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	1.38E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	6.14E-06	6.13E-06	mr1361	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	5.00E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	5.77E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	1.47E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	4.23E-16	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	2.11E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	8.57E-06	mr1621	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	1.89E-08	mr1626	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	3.78E-08	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	1.79E-06	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	1.24E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	6.21E-07	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	1.91E-10	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	1.42E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	1.70E-07	mr1965	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	3.44E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	5.36E-06	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	1.49E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	6.11E-10	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	8.65E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	1.20E-09	mr1902_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	1.52E-07	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	1.18E-06	mr1923_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423976382	NA	5.92E-06	mr1923_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251