Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0423902951:

Variant ID: vg0423902951 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23902951
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAACACCATAACAGACCCAATCATGATGACCACACCAAGACATGATAGTTATTGACGAGGTTTAGCCGGATTCTACGTCCTCGAGGCATCAGTTACATGC[A/G]
TTCCTCTTTGATCTAACATAATTACAACTAGCATGGTGGCCCGCGCAGCTTGCGCGGCTATCATCATTATATTTTCTCACATATAATAGCATATATGTTT

Reverse complement sequence

AAACATATATGCTATTATATGTGAGAAAATATAATGATGATAGCCGCGCAAGCTGCGCGGGCCACCATGCTAGTTGTAATTATGTTAGATCAAAGAGGAA[T/C]
GCATGTAACTGATGCCTCGAGGACGTAGAATCCGGCTAAACCTCGTCAATAACTATCATGTCTTGGTGTGGTCATCATGATTGGGTCTGTTATGGTGTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 8.20% 0.02% 0.02% NA
All Indica  2759 89.70% 10.30% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 64.70% 34.90% 0.00% 0.37% NA
Indica I  595 93.80% 6.20% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 81.20% 18.70% 0.11% 0.00% NA
Indica Intermediate  786 91.50% 8.50% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423902951 A -> DEL N N silent_mutation Average:37.065; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N
vg0423902951 A -> G LOC_Os04g40150-LOC_Os04g40170 intergenic_region ; MODIFIER silent_mutation Average:37.065; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423902951 NA 2.35E-07 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902951 NA 2.60E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902951 NA 3.20E-06 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902951 1.37E-07 1.37E-07 mr1260 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902951 NA 9.82E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902951 NA 4.93E-10 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902951 1.25E-06 NA mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902951 2.27E-07 1.84E-08 mr1244_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902951 NA 6.41E-06 mr1549_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902951 NA 2.97E-06 mr1708_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251