Variant ID: vg0423902951 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 23902951 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAACACCATAACAGACCCAATCATGATGACCACACCAAGACATGATAGTTATTGACGAGGTTTAGCCGGATTCTACGTCCTCGAGGCATCAGTTACATGC[A/G]
TTCCTCTTTGATCTAACATAATTACAACTAGCATGGTGGCCCGCGCAGCTTGCGCGGCTATCATCATTATATTTTCTCACATATAATAGCATATATGTTT
AAACATATATGCTATTATATGTGAGAAAATATAATGATGATAGCCGCGCAAGCTGCGCGGGCCACCATGCTAGTTGTAATTATGTTAGATCAAAGAGGAA[T/C]
GCATGTAACTGATGCCTCGAGGACGTAGAATCCGGCTAAACCTCGTCAATAACTATCATGTCTTGGTGTGGTCATCATGATTGGGTCTGTTATGGTGTTA
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 91.70% | 8.20% | 0.02% | 0.02% | NA |
All Indica | 2759 | 89.70% | 10.30% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 64.70% | 34.90% | 0.00% | 0.37% | NA |
Indica I | 595 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
Indica III | 913 | 81.20% | 18.70% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0423902951 | A -> DEL | N | N | silent_mutation | Average:37.065; most accessible tissue: Zhenshan97 young leaf, score: 61.964 | N | N | N | N |
vg0423902951 | A -> G | LOC_Os04g40150-LOC_Os04g40170 | intergenic_region ; MODIFIER | silent_mutation | Average:37.065; most accessible tissue: Zhenshan97 young leaf, score: 61.964 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0423902951 | NA | 2.35E-07 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902951 | NA | 2.60E-06 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902951 | NA | 3.20E-06 | mr1220 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902951 | 1.37E-07 | 1.37E-07 | mr1260 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902951 | NA | 9.82E-07 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902951 | NA | 4.93E-10 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902951 | 1.25E-06 | NA | mr1244_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902951 | 2.27E-07 | 1.84E-08 | mr1244_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902951 | NA | 6.41E-06 | mr1549_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902951 | NA | 2.97E-06 | mr1708_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |