\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423902918:

Variant ID: vg0423902918 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23902918
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCATGACATTGGCCTCGTTTCCAAACACGAAATAACACCATAACAGACCCAATCATGATGACCACACCAAGACATGATAGTTATTGACGAGGTTTAGCC[G/A]
GATTCTACGTCCTCGAGGCATCAGTTACATGCATTCCTCTTTGATCTAACATAATTACAACTAGCATGGTGGCCCGCGCAGCTTGCGCGGCTATCATCAT

Reverse complement sequence

ATGATGATAGCCGCGCAAGCTGCGCGGGCCACCATGCTAGTTGTAATTATGTTAGATCAAAGAGGAATGCATGTAACTGATGCCTCGAGGACGTAGAATC[C/T]
GGCTAAACCTCGTCAATAACTATCATGTCTTGGTGTGGTCATCATGATTGGGTCTGTTATGGTGTTATTTCGTGTTTGGAAACGAGGCCAATGTCATGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 8.30% 0.04% 0.00% NA
All Indica  2759 89.60% 10.30% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 64.70% 35.30% 0.00% 0.00% NA
Indica I  595 93.80% 6.20% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 81.20% 18.80% 0.00% 0.00% NA
Indica Intermediate  786 91.20% 8.50% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423902918 G -> A LOC_Os04g40150-LOC_Os04g40170 intergenic_region ; MODIFIER silent_mutation Average:40.948; most accessible tissue: Zhenshan97 young leaf, score: 67.83 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423902918 NA 2.88E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902918 NA 6.64E-06 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902918 4.88E-07 4.88E-07 mr1260 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902918 NA 4.07E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902918 NA 6.78E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902918 NA 1.72E-10 mr1705 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902918 2.29E-06 NA mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902918 8.24E-07 5.89E-08 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423902918 NA 9.87E-06 mr1708_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251