Variant ID: vg0423902918 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 23902918 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGCATGACATTGGCCTCGTTTCCAAACACGAAATAACACCATAACAGACCCAATCATGATGACCACACCAAGACATGATAGTTATTGACGAGGTTTAGCC[G/A]
GATTCTACGTCCTCGAGGCATCAGTTACATGCATTCCTCTTTGATCTAACATAATTACAACTAGCATGGTGGCCCGCGCAGCTTGCGCGGCTATCATCAT
ATGATGATAGCCGCGCAAGCTGCGCGGGCCACCATGCTAGTTGTAATTATGTTAGATCAAAGAGGAATGCATGTAACTGATGCCTCGAGGACGTAGAATC[C/T]
GGCTAAACCTCGTCAATAACTATCATGTCTTGGTGTGGTCATCATGATTGGGTCTGTTATGGTGTTATTTCGTGTTTGGAAACGAGGCCAATGTCATGCT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 91.70% | 8.30% | 0.04% | 0.00% | NA |
All Indica | 2759 | 89.60% | 10.30% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 64.70% | 35.30% | 0.00% | 0.00% | NA |
Indica I | 595 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
Indica III | 913 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 91.20% | 8.50% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0423902918 | G -> A | LOC_Os04g40150-LOC_Os04g40170 | intergenic_region ; MODIFIER | silent_mutation | Average:40.948; most accessible tissue: Zhenshan97 young leaf, score: 67.83 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0423902918 | NA | 2.88E-06 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902918 | NA | 6.64E-06 | mr1220 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902918 | 4.88E-07 | 4.88E-07 | mr1260 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902918 | NA | 4.07E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902918 | NA | 6.78E-06 | mr1654 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902918 | NA | 1.72E-10 | mr1705 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902918 | 2.29E-06 | NA | mr1244_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902918 | 8.24E-07 | 5.89E-08 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423902918 | NA | 9.87E-06 | mr1708_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |