\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423871567:

Variant ID: vg0423871567 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23871567
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.02, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


CCCTGCAATAATCTTGATTTCGAAGGAGTCCTCACAATAATCGCCGGCGTTAAGGACTGATATTTCTACACTATTTTACAATCCCTGCAATAATCTTGAT[T/G]
TCGAAAGAGTCCTCACAAAAATCGCCGCGTTAAGGACCCGATATTTCTACACAGTTTCACAATCGCAAACAATACAGAAACGATCTAATCCTGGGCGCCC

Reverse complement sequence

GGGCGCCCAGGATTAGATCGTTTCTGTATTGTTTGCGATTGTGAAACTGTGTAGAAATATCGGGTCCTTAACGCGGCGATTTTTGTGAGGACTCTTTCGA[A/C]
ATCAAGATTATTGCAGGGATTGTAAAATAGTGTAGAAATATCAGTCCTTAACGCCGGCGATTATTGTGAGGACTCCTTCGAAATCAAGATTATTGCAGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 41.40% 0.17% 0.13% NA
All Indica  2759 94.60% 5.00% 0.18% 0.22% NA
All Japonica  1512 0.30% 99.70% 0.00% 0.00% NA
Aus  269 39.40% 60.60% 0.00% 0.00% NA
Indica I  595 92.30% 7.20% 0.17% 0.34% NA
Indica II  465 96.80% 3.00% 0.22% 0.00% NA
Indica III  913 96.70% 3.10% 0.11% 0.11% NA
Indica Intermediate  786 92.70% 6.60% 0.25% 0.38% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 35.60% 61.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423871567 T -> DEL N N silent_mutation Average:85.398; most accessible tissue: Minghui63 flag leaf, score: 96.931 N N N N
vg0423871567 T -> G LOC_Os04g40100.1 upstream_gene_variant ; 4760.0bp to feature; MODIFIER silent_mutation Average:85.398; most accessible tissue: Minghui63 flag leaf, score: 96.931 N N N N
vg0423871567 T -> G LOC_Os04g40080.1 downstream_gene_variant ; 4245.0bp to feature; MODIFIER silent_mutation Average:85.398; most accessible tissue: Minghui63 flag leaf, score: 96.931 N N N N
vg0423871567 T -> G LOC_Os04g40090.1 intron_variant ; MODIFIER silent_mutation Average:85.398; most accessible tissue: Minghui63 flag leaf, score: 96.931 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0423871567 T G -0.01 -0.01 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423871567 7.29E-07 NA mr1248 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 9.87E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 4.78E-45 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 3.31E-48 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 3.10E-21 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 1.13E-57 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 7.73E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 7.12E-19 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 3.95E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 1.10E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 2.34E-62 mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 1.00E-16 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 1.43E-44 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 1.17E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 7.09E-30 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 1.13E-18 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 4.28E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 3.78E-78 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 6.84E-49 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 1.29E-67 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423871567 NA 5.92E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251