\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423663984:

Variant ID: vg0423663984 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23663984
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCGCATACGGATACTCTCTGCATACATTAAGGAAATCCTTCACGGAGTTTACGGATAGAAAGAGTTCTACTCGGACAAGACTGGGTTGTCAATGTATC[G/A]
TGTAAGGTCTGATGTCTCCGAGTTCTACTGGGAAACCGCCTGACCTGCGATATAAAAGGGACCCCCCGGGGAGGACCTAAGGCATTGAATCTCAGAGCCA

Reverse complement sequence

TGGCTCTGAGATTCAATGCCTTAGGTCCTCCCCGGGGGGTCCCTTTTATATCGCAGGTCAGGCGGTTTCCCAGTAGAACTCGGAGACATCAGACCTTACA[C/T]
GATACATTGACAACCCAGTCTTGTCCGAGTAGAACTCTTTCTATCCGTAAACTCCGTGAAGGATTTCCTTAATGTATGCAGAGAGTATCCGTATGCGCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 46.80% 0.70% 1.06% NA
All Indica  2759 19.50% 77.60% 1.16% 1.78% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 84.40% 15.60% 0.00% 0.00% NA
Indica I  595 26.70% 67.10% 3.53% 2.69% NA
Indica II  465 7.70% 90.10% 0.22% 1.94% NA
Indica III  913 19.50% 79.10% 0.66% 0.77% NA
Indica Intermediate  786 21.00% 76.30% 0.51% 2.16% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 71.10% 26.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423663984 G -> DEL N N silent_mutation Average:56.814; most accessible tissue: Minghui63 young leaf, score: 74.007 N N N N
vg0423663984 G -> A LOC_Os04g39700.1 upstream_gene_variant ; 943.0bp to feature; MODIFIER silent_mutation Average:56.814; most accessible tissue: Minghui63 young leaf, score: 74.007 N N N N
vg0423663984 G -> A LOC_Os04g39710.1 upstream_gene_variant ; 440.0bp to feature; MODIFIER silent_mutation Average:56.814; most accessible tissue: Minghui63 young leaf, score: 74.007 N N N N
vg0423663984 G -> A LOC_Os04g39700-LOC_Os04g39710 intergenic_region ; MODIFIER silent_mutation Average:56.814; most accessible tissue: Minghui63 young leaf, score: 74.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423663984 NA 4.01E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984 NA 1.44E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984 NA 1.09E-09 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984 NA 1.46E-17 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984 NA 2.77E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984 NA 2.52E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984 NA 3.19E-14 mr1713 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984 NA 3.32E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984 NA 4.34E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984 NA 7.96E-12 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984 NA 7.48E-12 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984 NA 4.67E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251