Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423663984:

Variant ID: vg0423663984 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 23663984
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

ACGCGCATACGGATACTCTCTGCATACATTAAGGAAATCCTTCACGGAGTTTACGGATAGAAAGAGTTCTACTCGGACAAGACTGGGTTGTCAATGTATC[G/A]
TGTAAGGTCTGATGTCTCCGAGTTCTACTGGGAAACCGCCTGACCTGCGATATAAAAGGGACCCCCCGGGGAGGACCTAAGGCATTGAATCTCAGAGCCA

Reverse complement sequence

TGGCTCTGAGATTCAATGCCTTAGGTCCTCCCCGGGGGGTCCCTTTTATATCGCAGGTCAGGCGGTTTCCCAGTAGAACTCGGAGACATCAGACCTTACA[C/T]
GATACATTGACAACCCAGTCTTGTCCGAGTAGAACTCTTTCTATCCGTAAACTCCGTGAAGGATTTCCTTAATGTATGCAGAGAGTATCCGTATGCGCGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.40%	46.80%	0.70%	1.06%	NA
All Indica	2759	19.50%	77.60%	1.16%	1.78%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	84.40%	15.60%	0.00%	0.00%	NA
Indica I	595	26.70%	67.10%	3.53%	2.69%	NA
Indica II	465	7.70%	90.10%	0.22%	1.94%	NA
Indica III	913	19.50%	79.10%	0.66%	0.77%	NA
Indica Intermediate	786	21.00%	76.30%	0.51%	2.16%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	71.10%	26.70%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0423663984	G -> DEL	N	N	silent_mutation	Average:56.814; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N
vg0423663984	G -> A	LOC_Os04g39700.1	upstream_gene_variant ; 943.0bp to feature; MODIFIER	silent_mutation	Average:56.814; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N
vg0423663984	G -> A	LOC_Os04g39710.1	upstream_gene_variant ; 440.0bp to feature; MODIFIER	silent_mutation	Average:56.814; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N
vg0423663984	G -> A	LOC_Os04g39700-LOC_Os04g39710	intergenic_region ; MODIFIER	silent_mutation	Average:56.814; most accessible tissue: Minghui63 young leaf, score: 74.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0423663984	NA	4.01E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984	NA	1.44E-09	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984	NA	1.09E-09	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984	NA	1.46E-17	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984	NA	2.77E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984	NA	2.52E-16	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984	NA	3.19E-14	mr1713	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984	NA	3.32E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984	NA	4.34E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984	NA	7.96E-12	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984	NA	7.48E-12	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423663984	NA	4.67E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251