\
| Variant ID: vg0423663984 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 23663984 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )
ACGCGCATACGGATACTCTCTGCATACATTAAGGAAATCCTTCACGGAGTTTACGGATAGAAAGAGTTCTACTCGGACAAGACTGGGTTGTCAATGTATC[G/A]
TGTAAGGTCTGATGTCTCCGAGTTCTACTGGGAAACCGCCTGACCTGCGATATAAAAGGGACCCCCCGGGGAGGACCTAAGGCATTGAATCTCAGAGCCA
TGGCTCTGAGATTCAATGCCTTAGGTCCTCCCCGGGGGGTCCCTTTTATATCGCAGGTCAGGCGGTTTCCCAGTAGAACTCGGAGACATCAGACCTTACA[C/T]
GATACATTGACAACCCAGTCTTGTCCGAGTAGAACTCTTTCTATCCGTAAACTCCGTGAAGGATTTCCTTAATGTATGCAGAGAGTATCCGTATGCGCGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.40% | 46.80% | 0.70% | 1.06% | NA |
| All Indica | 2759 | 19.50% | 77.60% | 1.16% | 1.78% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 26.70% | 67.10% | 3.53% | 2.69% | NA |
| Indica II | 465 | 7.70% | 90.10% | 0.22% | 1.94% | NA |
| Indica III | 913 | 19.50% | 79.10% | 0.66% | 0.77% | NA |
| Indica Intermediate | 786 | 21.00% | 76.30% | 0.51% | 2.16% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 26.70% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0423663984 | G -> DEL | N | N | silent_mutation | Average:56.814; most accessible tissue: Minghui63 young leaf, score: 74.007 | N | N | N | N |
| vg0423663984 | G -> A | LOC_Os04g39700.1 | upstream_gene_variant ; 943.0bp to feature; MODIFIER | silent_mutation | Average:56.814; most accessible tissue: Minghui63 young leaf, score: 74.007 | N | N | N | N |
| vg0423663984 | G -> A | LOC_Os04g39710.1 | upstream_gene_variant ; 440.0bp to feature; MODIFIER | silent_mutation | Average:56.814; most accessible tissue: Minghui63 young leaf, score: 74.007 | N | N | N | N |
| vg0423663984 | G -> A | LOC_Os04g39700-LOC_Os04g39710 | intergenic_region ; MODIFIER | silent_mutation | Average:56.814; most accessible tissue: Minghui63 young leaf, score: 74.007 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0423663984 | NA | 4.01E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423663984 | NA | 1.44E-09 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423663984 | NA | 1.09E-09 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423663984 | NA | 1.46E-17 | mr1552 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423663984 | NA | 2.77E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423663984 | NA | 2.52E-16 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423663984 | NA | 3.19E-14 | mr1713 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423663984 | NA | 3.32E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423663984 | NA | 4.34E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423663984 | NA | 7.96E-12 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423663984 | NA | 7.48E-12 | mr1883 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423663984 | NA | 4.67E-10 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |