\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423639987:

Variant ID: vg0423639987 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23639987
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, T: 0.30, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTTTTCTATATGCACAATTTCTCGATGTTTCGATGAGAATTTCTTGACTTTCCATATATAGAAAGAGATAGACTATAAATGACATCTCTTATGTCAAT[T/A]
AGACCAAAGGGATGGATATTAAATGATAGGAAGTGCTAGGAAGTGAAATAGAATGAAATAGAGCCACTCTGGGCTTACCTATGAAATGAGGCATGGAACG

Reverse complement sequence

CGTTCCATGCCTCATTTCATAGGTAAGCCCAGAGTGGCTCTATTTCATTCTATTTCACTTCCTAGCACTTCCTATCATTTAATATCCATCCCTTTGGTCT[A/T]
ATTGACATAAGAGATGTCATTTATAGTCTATCTCTTTCTATATATGGAAAGTCAAGAAATTCTCATCGAAACATCGAGAAATTGTGCATATAGAAAACTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 45.20% 1.95% 0.00% NA
All Indica  2759 85.60% 11.20% 3.15% 0.00% NA
All Japonica  1512 0.30% 99.70% 0.00% 0.00% NA
Aus  269 36.80% 61.30% 1.86% 0.00% NA
Indica I  595 73.30% 21.30% 5.38% 0.00% NA
Indica II  465 93.10% 5.80% 1.08% 0.00% NA
Indica III  913 90.50% 6.40% 3.18% 0.00% NA
Indica Intermediate  786 85.00% 12.30% 2.67% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 34.40% 65.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423639987 T -> A LOC_Os04g39680.1 upstream_gene_variant ; 866.0bp to feature; MODIFIER silent_mutation Average:12.776; most accessible tissue: Callus, score: 44.389 N N N N
vg0423639987 T -> A LOC_Os04g39670.1 downstream_gene_variant ; 4716.0bp to feature; MODIFIER silent_mutation Average:12.776; most accessible tissue: Callus, score: 44.389 N N N N
vg0423639987 T -> A LOC_Os04g39670-LOC_Os04g39680 intergenic_region ; MODIFIER silent_mutation Average:12.776; most accessible tissue: Callus, score: 44.389 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423639987 NA 3.27E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423639987 NA 1.83E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423639987 NA 3.42E-11 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423639987 NA 9.76E-22 mr1416 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423639987 NA 8.03E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423639987 NA 9.71E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423639987 NA 6.92E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423639987 NA 6.79E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423639987 NA 4.09E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423639987 NA 6.19E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423639987 NA 1.04E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423639987 NA 2.54E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423639987 NA 8.49E-14 mr1883 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423639987 NA 1.60E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251