\
| Variant ID: vg0423538981 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 23538981 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.25, others allele: 0.00, population size: 150. )
GAATAGGGGTATGATGCAGGGAATTATCAAAGGAGAGCTAGAGTGGTTCATTTGCATAAAGCGAGCATTTATAAACAGAAGCTCAAAGAAGAAAACAGTC[G/A]
TAATAATTAATCAATATTAATCATCCACTGTCCAACGCTATACCACGTTGCGACAGGCCCAACCATCCACCTATACTATCCAATTTCACTAGACTAAACT
AGTTTAGTCTAGTGAAATTGGATAGTATAGGTGGATGGTTGGGCCTGTCGCAACGTGGTATAGCGTTGGACAGTGGATGATTAATATTGATTAATTATTA[C/T]
GACTGTTTTCTTCTTTGAGCTTCTGTTTATAAATGCTCGCTTTATGCAAATGAACCACTCTAGCTCTCCTTTGATAATTCCCTGCATCATACCCCTATTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.50% | 39.90% | 2.56% | 0.00% | NA |
| All Indica | 2759 | 30.60% | 65.50% | 3.88% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 76.20% | 19.30% | 4.46% | 0.00% | NA |
| Indica I | 595 | 81.30% | 17.30% | 1.34% | 0.00% | NA |
| Indica II | 465 | 8.60% | 89.50% | 1.94% | 0.00% | NA |
| Indica III | 913 | 13.40% | 80.60% | 6.02% | 0.00% | NA |
| Indica Intermediate | 786 | 25.30% | 70.20% | 4.45% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 25.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0423538981 | G -> A | LOC_Os04g39530.1 | upstream_gene_variant ; 1491.0bp to feature; MODIFIER | silent_mutation | Average:32.365; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0423538981 | G -> A | LOC_Os04g39540.1 | downstream_gene_variant ; 4961.0bp to feature; MODIFIER | silent_mutation | Average:32.365; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0423538981 | G -> A | LOC_Os04g39530-LOC_Os04g39540 | intergenic_region ; MODIFIER | silent_mutation | Average:32.365; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0423538981 | NA | 9.61E-07 | mr1035 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423538981 | NA | 1.43E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423538981 | NA | 7.80E-07 | mr1057 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423538981 | NA | 7.71E-07 | mr1254 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423538981 | NA | 1.51E-06 | mr1266 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423538981 | 3.54E-06 | 3.56E-06 | mr1688 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0423538981 | 1.49E-06 | 1.49E-06 | mr1688 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |