\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423538981:

Variant ID: vg0423538981 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23538981
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.25, others allele: 0.00, population size: 150. )

Flanking Sequence (100 bp) in Reference Genome:


GAATAGGGGTATGATGCAGGGAATTATCAAAGGAGAGCTAGAGTGGTTCATTTGCATAAAGCGAGCATTTATAAACAGAAGCTCAAAGAAGAAAACAGTC[G/A]
TAATAATTAATCAATATTAATCATCCACTGTCCAACGCTATACCACGTTGCGACAGGCCCAACCATCCACCTATACTATCCAATTTCACTAGACTAAACT

Reverse complement sequence

AGTTTAGTCTAGTGAAATTGGATAGTATAGGTGGATGGTTGGGCCTGTCGCAACGTGGTATAGCGTTGGACAGTGGATGATTAATATTGATTAATTATTA[C/T]
GACTGTTTTCTTCTTTGAGCTTCTGTTTATAAATGCTCGCTTTATGCAAATGAACCACTCTAGCTCTCCTTTGATAATTCCCTGCATCATACCCCTATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.50% 39.90% 2.56% 0.00% NA
All Indica  2759 30.60% 65.50% 3.88% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 76.20% 19.30% 4.46% 0.00% NA
Indica I  595 81.30% 17.30% 1.34% 0.00% NA
Indica II  465 8.60% 89.50% 1.94% 0.00% NA
Indica III  913 13.40% 80.60% 6.02% 0.00% NA
Indica Intermediate  786 25.30% 70.20% 4.45% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 72.20% 25.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423538981 G -> A LOC_Os04g39530.1 upstream_gene_variant ; 1491.0bp to feature; MODIFIER silent_mutation Average:32.365; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0423538981 G -> A LOC_Os04g39540.1 downstream_gene_variant ; 4961.0bp to feature; MODIFIER silent_mutation Average:32.365; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0423538981 G -> A LOC_Os04g39530-LOC_Os04g39540 intergenic_region ; MODIFIER silent_mutation Average:32.365; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423538981 NA 9.61E-07 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423538981 NA 1.43E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423538981 NA 7.80E-07 mr1057 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423538981 NA 7.71E-07 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423538981 NA 1.51E-06 mr1266 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423538981 3.54E-06 3.56E-06 mr1688 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423538981 1.49E-06 1.49E-06 mr1688 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251