Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423538981:

Variant ID: vg0423538981 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 23538981
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.25, others allele: 0.00, population size: 150. )

Flanking Sequence (100 bp) in Reference Genome:

GAATAGGGGTATGATGCAGGGAATTATCAAAGGAGAGCTAGAGTGGTTCATTTGCATAAAGCGAGCATTTATAAACAGAAGCTCAAAGAAGAAAACAGTC[G/A]
TAATAATTAATCAATATTAATCATCCACTGTCCAACGCTATACCACGTTGCGACAGGCCCAACCATCCACCTATACTATCCAATTTCACTAGACTAAACT

Reverse complement sequence

AGTTTAGTCTAGTGAAATTGGATAGTATAGGTGGATGGTTGGGCCTGTCGCAACGTGGTATAGCGTTGGACAGTGGATGATTAATATTGATTAATTATTA[C/T]
GACTGTTTTCTTCTTTGAGCTTCTGTTTATAAATGCTCGCTTTATGCAAATGAACCACTCTAGCTCTCCTTTGATAATTCCCTGCATCATACCCCTATTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.50%	39.90%	2.56%	0.00%	NA
All Indica	2759	30.60%	65.50%	3.88%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	76.20%	19.30%	4.46%	0.00%	NA
Indica I	595	81.30%	17.30%	1.34%	0.00%	NA
Indica II	465	8.60%	89.50%	1.94%	0.00%	NA
Indica III	913	13.40%	80.60%	6.02%	0.00%	NA
Indica Intermediate	786	25.30%	70.20%	4.45%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	72.20%	25.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0423538981	G -> A	LOC_Os04g39530.1	upstream_gene_variant ; 1491.0bp to feature; MODIFIER	silent_mutation	Average:32.365; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0423538981	G -> A	LOC_Os04g39540.1	downstream_gene_variant ; 4961.0bp to feature; MODIFIER	silent_mutation	Average:32.365; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0423538981	G -> A	LOC_Os04g39530-LOC_Os04g39540	intergenic_region ; MODIFIER	silent_mutation	Average:32.365; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0423538981	NA	9.61E-07	mr1035	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423538981	NA	1.43E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423538981	NA	7.80E-07	mr1057	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423538981	NA	7.71E-07	mr1254	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423538981	NA	1.51E-06	mr1266	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423538981	3.54E-06	3.56E-06	mr1688	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423538981	1.49E-06	1.49E-06	mr1688	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251