\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423537134:

Variant ID: vg0423537134 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23537134
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, G: 0.11, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TAACCGCGTTTCCATCATCTACTTGACTGTTAAGGGACATCACATCATTACTATATTCGTCGTCACCTTCAGGGACATCAATAAACTTTTCTGGAGATAT[G/T]
TTGCTTCCTTGGTGATTCAACCAACCCTCATCCCCATTAAGCATCCGTATAAGATTGTGGAACACCACTGTGGCAACTGGAATCTTCACTTGGTTTTCAA

Reverse complement sequence

TTGAAAACCAAGTGAAGATTCCAGTTGCCACAGTGGTGTTCCACAATCTTATACGGATGCTTAATGGGGATGAGGGTTGGTTGAATCACCAAGGAAGCAA[C/A]
ATATCTCCAGAAAAGTTTATTGATGTCCCTGAAGGTGACGACGAATATAGTAATGATGTGATGTCCCTTAACAGTCAAGTAGATGATGGAAACGCGGTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 2.70% 39.25% 0.02% NA
All Indica  2759 31.00% 4.40% 64.62% 0.04% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 80.30% 0.70% 18.96% 0.00% NA
Indica I  595 81.70% 0.50% 17.82% 0.00% NA
Indica II  465 9.90% 5.40% 84.52% 0.22% NA
Indica III  913 13.40% 5.90% 80.72% 0.00% NA
Indica Intermediate  786 25.40% 5.00% 69.59% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 77.80% 2.20% 20.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423537134 G -> DEL LOC_Os04g39530.1 N frameshift_variant Average:19.024; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0423537134 G -> T LOC_Os04g39530.1 missense_variant ; p.Asn119Lys; MODERATE nonsynonymous_codon Average:19.024; most accessible tissue: Zhenshan97 root, score: 38.035 possibly damaging 1.504 DELETERIOUS 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423537134 NA 1.22E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0423537134 NA 7.40E-17 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0423537134 NA 2.01E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 3.79E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 7.88E-06 mr1057 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 5.01E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 1.21E-07 mr1136 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 4.31E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 9.00E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 7.11E-07 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 2.78E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 5.77E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 9.90E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 1.18E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 9.75E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 4.75E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 8.22E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 9.06E-07 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 2.83E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 8.00E-09 mr1928 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 2.90E-07 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 2.67E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 5.30E-06 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 9.82E-10 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423537134 NA 1.26E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251