Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0423486114:

Variant ID: vg0423486114 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23486114
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


TGCCGGGCTAAGCTAGCTATACAGTTTTATATGTATACCACGCGTACGTACGTACGTGCACAGTACTCCCTCCGTACACGTACTACATGCACCGTACTAC[C/T]
GTAGTTAGCTATACAGATAGTATTACTTTTCGTCTTTTCGTACACTAGCTAGCTTATGGACCATATATACGCATATGCGTTACTCCTTTCGTTTCAATAA

Reverse complement sequence

TTATTGAAACGAAAGGAGTAACGCATATGCGTATATATGGTCCATAAGCTAGCTAGTGTACGAAAAGACGAAAAGTAATACTATCTGTATAGCTAACTAC[G/A]
GTAGTACGGTGCATGTAGTACGTGTACGGAGGGAGTACTGTGCACGTACGTACGTACGCGTGGTATACATATAAAACTGTATAGCTAGCTTAGCCCGGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.50% 13.10% 0.40% 0.00% NA
All Indica  2759 79.50% 20.30% 0.14% 0.00% NA
All Japonica  1512 95.50% 3.50% 0.99% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 25.90% 73.80% 0.34% 0.00% NA
Indica II  465 94.20% 5.80% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 88.00% 11.70% 0.25% 0.00% NA
Temperate Japonica  767 98.00% 0.50% 1.43% 0.00% NA
Tropical Japonica  504 90.70% 9.10% 0.20% 0.00% NA
Japonica Intermediate  241 97.50% 1.20% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423486114 C -> T LOC_Os04g39430-LOC_Os04g39440 intergenic_region ; MODIFIER silent_mutation Average:65.222; most accessible tissue: Minghui63 panicle, score: 97.507 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0423486114 C T 0.01 0.01 0.0 0.06 0.06 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423486114 NA 4.55E-12 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0423486114 NA 9.42E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423486114 NA 4.35E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423486114 NA 6.94E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423486114 NA 9.52E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423486114 NA 6.16E-06 mr1621 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423486114 8.73E-06 NA mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423486114 7.93E-06 1.60E-07 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423486114 1.44E-06 NA mr1693 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423486114 NA 2.34E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251