\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423407379:

Variant ID: vg0423407379 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23407379
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAGTGGCCTACCATATGTTTAAAAGTTATTAATCTTATCTATATATCTAGAAATAGAAGTAGTACCGACTACTACGGAGTAGTACAAGTCCATGTACAC[A/C]
AGTGTTATACTCCCTCCGTCCCATAATATGAGGGATCTTAACATTTTCTTGTACTGTTTGACTACTCGTCTTATTCAAAAATTTTTTGTGTAAATATAAA

Reverse complement sequence

TTTATATTTACACAAAAAATTTTTGAATAAGACGAGTAGTCAAACAGTACAAGAAAATGTTAAGATCCCTCATATTATGGGACGGAGGGAGTATAACACT[T/G]
GTGTACATGGACTTGTACTACTCCGTAGTAGTCGGTACTACTTCTATTTCTAGATATATAGATAAGATTAATAACTTTTAAACATATGGTAGGCCACTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.90% 10.10% 2.98% 0.00% NA
All Indica  2759 98.10% 1.00% 0.87% 0.00% NA
All Japonica  1512 64.60% 27.90% 7.47% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 94.50% 3.40% 2.18% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 1.00% 1.27% 0.00% NA
Temperate Japonica  767 44.30% 43.90% 11.73% 0.00% NA
Tropical Japonica  504 93.50% 4.40% 2.18% 0.00% NA
Japonica Intermediate  241 68.90% 26.10% 4.98% 0.00% NA
VI/Aromatic  96 87.50% 11.50% 1.04% 0.00% NA
Intermediate  90 82.20% 15.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423407379 A -> C LOC_Os04g39310.1 downstream_gene_variant ; 1180.0bp to feature; MODIFIER silent_mutation Average:47.809; most accessible tissue: Zhenshan97 root, score: 71.174 N N N N
vg0423407379 A -> C LOC_Os04g39320.1 downstream_gene_variant ; 997.0bp to feature; MODIFIER silent_mutation Average:47.809; most accessible tissue: Zhenshan97 root, score: 71.174 N N N N
vg0423407379 A -> C LOC_Os04g39320.4 downstream_gene_variant ; 997.0bp to feature; MODIFIER silent_mutation Average:47.809; most accessible tissue: Zhenshan97 root, score: 71.174 N N N N
vg0423407379 A -> C LOC_Os04g39320.2 downstream_gene_variant ; 997.0bp to feature; MODIFIER silent_mutation Average:47.809; most accessible tissue: Zhenshan97 root, score: 71.174 N N N N
vg0423407379 A -> C LOC_Os04g39310-LOC_Os04g39320 intergenic_region ; MODIFIER silent_mutation Average:47.809; most accessible tissue: Zhenshan97 root, score: 71.174 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423407379 NA 1.58E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 1.48E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 8.11E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 5.10E-09 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 1.00E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 9.97E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 7.28E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 1.82E-08 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 5.44E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 6.72E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 3.07E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 3.91E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 1.06E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 2.52E-07 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 3.87E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 1.89E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 5.78E-06 1.96E-13 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 3.87E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 1.92E-07 7.35E-17 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 5.39E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 5.30E-18 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 NA 9.41E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379 4.01E-07 NA mr1933_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251