Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423407379:

Variant ID: vg0423407379 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 23407379
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAGTGGCCTACCATATGTTTAAAAGTTATTAATCTTATCTATATATCTAGAAATAGAAGTAGTACCGACTACTACGGAGTAGTACAAGTCCATGTACAC[A/C]
AGTGTTATACTCCCTCCGTCCCATAATATGAGGGATCTTAACATTTTCTTGTACTGTTTGACTACTCGTCTTATTCAAAAATTTTTTGTGTAAATATAAA

Reverse complement sequence

TTTATATTTACACAAAAAATTTTTGAATAAGACGAGTAGTCAAACAGTACAAGAAAATGTTAAGATCCCTCATATTATGGGACGGAGGGAGTATAACACT[T/G]
GTGTACATGGACTTGTACTACTCCGTAGTAGTCGGTACTACTTCTATTTCTAGATATATAGATAAGATTAATAACTTTTAAACATATGGTAGGCCACTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.90%	10.10%	2.98%	0.00%	NA
All Indica	2759	98.10%	1.00%	0.87%	0.00%	NA
All Japonica	1512	64.60%	27.90%	7.47%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	94.50%	3.40%	2.18%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	1.00%	1.27%	0.00%	NA
Temperate Japonica	767	44.30%	43.90%	11.73%	0.00%	NA
Tropical Japonica	504	93.50%	4.40%	2.18%	0.00%	NA
Japonica Intermediate	241	68.90%	26.10%	4.98%	0.00%	NA
VI/Aromatic	96	87.50%	11.50%	1.04%	0.00%	NA
Intermediate	90	82.20%	15.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0423407379	A -> C	LOC_Os04g39310.1	downstream_gene_variant ; 1180.0bp to feature; MODIFIER	silent_mutation	Average:47.809; most accessible tissue: Zhenshan97 root, score: 71.174	N	N	N	N
vg0423407379	A -> C	LOC_Os04g39320.1	downstream_gene_variant ; 997.0bp to feature; MODIFIER	silent_mutation	Average:47.809; most accessible tissue: Zhenshan97 root, score: 71.174	N	N	N	N
vg0423407379	A -> C	LOC_Os04g39320.4	downstream_gene_variant ; 997.0bp to feature; MODIFIER	silent_mutation	Average:47.809; most accessible tissue: Zhenshan97 root, score: 71.174	N	N	N	N
vg0423407379	A -> C	LOC_Os04g39320.2	downstream_gene_variant ; 997.0bp to feature; MODIFIER	silent_mutation	Average:47.809; most accessible tissue: Zhenshan97 root, score: 71.174	N	N	N	N
vg0423407379	A -> C	LOC_Os04g39310-LOC_Os04g39320	intergenic_region ; MODIFIER	silent_mutation	Average:47.809; most accessible tissue: Zhenshan97 root, score: 71.174	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0423407379	NA	1.58E-08	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	1.48E-06	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	8.11E-06	mr1544	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	5.10E-09	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	1.00E-10	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	9.97E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	7.28E-08	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	1.82E-08	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	5.44E-06	mr1045_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	6.72E-07	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	3.07E-08	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	3.91E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	1.06E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	2.52E-07	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	3.87E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	1.89E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	5.78E-06	1.96E-13	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	3.87E-06	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	1.92E-07	7.35E-17	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	5.39E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	5.30E-18	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	NA	9.41E-07	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423407379	4.01E-07	NA	mr1933_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251