\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423394772:

Variant ID: vg0423394772 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23394772
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCAATATTCAAGTAGAAAAAACAATTAAAAAAAGAAAAAGAAAAGAAGGTGACAGTCACATGGCGCTAATATTTTTACTCCCGGTTGGTAACCCTAACC[A/G]
GGACTAAAGATGGACATCTTTAGTTCTGGATTCAGGATCCCGGTTTGCAATCCGGGAGTAAAAGGGTTGCAAACCGAGACTAAAGCCCACTTCTCGAGTA

Reverse complement sequence

TACTCGAGAAGTGGGCTTTAGTCTCGGTTTGCAACCCTTTTACTCCCGGATTGCAAACCGGGATCCTGAATCCAGAACTAAAGATGTCCATCTTTAGTCC[T/C]
GGTTAGGGTTACCAACCGGGAGTAAAAATATTAGCGCCATGTGACTGTCACCTTCTTTTCTTTTTCTTTTTTTAATTGTTTTTTCTACTTGAATATTGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.40% 10.10% 2.50% 0.00% NA
All Indica  2759 98.30% 0.80% 0.94% 0.00% NA
All Japonica  1512 65.90% 28.40% 5.69% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 94.30% 2.70% 3.03% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 0.80% 0.89% 0.00% NA
Temperate Japonica  767 45.20% 45.10% 9.65% 0.00% NA
Tropical Japonica  504 94.80% 4.40% 0.79% 0.00% NA
Japonica Intermediate  241 71.40% 25.30% 3.32% 0.00% NA
VI/Aromatic  96 86.50% 11.50% 2.08% 0.00% NA
Intermediate  90 81.10% 15.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423394772 A -> G LOC_Os04g39300-LOC_Os04g39310 intergenic_region ; MODIFIER silent_mutation Average:33.23; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423394772 NA 2.96E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 NA 7.55E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 NA 8.17E-09 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 NA 9.29E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 NA 1.93E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 NA 6.85E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 NA 1.73E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 NA 6.54E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 NA 1.25E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 NA 4.04E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 NA 5.89E-08 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 NA 1.59E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 NA 5.81E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 1.25E-06 2.68E-13 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 6.19E-08 4.81E-17 mr1842_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 NA 8.77E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 1.14E-06 1.17E-19 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423394772 NA 4.44E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251