Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423367176:

Variant ID: vg0423367176 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 23367176
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

GTATATTTTAAGTTAAGAAGAGTACTGAATTGCTGCTAGTATTCTTTTCAAATTCCTGAAAGAGTTGTTCTATTAGGGTTCCAGATTGGGAGAGAGGAAA[T/A]
TCTGTTTATGCCAGTTGATAATTTTAATAAAATCAATTAAAAGTTTTATGTGATACATATAATTCATTTGATTAAACTAAAATAAATCATCTGGCATTAC

Reverse complement sequence

GTAATGCCAGATGATTTATTTTAGTTTAATCAAATGAATTATATGTATCACATAAAACTTTTAATTGATTTTATTAAAATTATCAACTGGCATAAACAGA[A/T]
TTTCCTCTCTCCCAATCTGGAACCCTAATAGAACAACTCTTTCAGGAATTTGAAAAGAATACTAGCAGCAATTCAGTACTCTTCTTAACTTAAAATATAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.40%	47.60%	2.01%	0.00%	NA
All Indica	2759	59.70%	38.60%	1.74%	0.00%	NA
All Japonica	1512	24.10%	73.40%	2.45%	0.00%	NA
Aus	269	89.20%	8.60%	2.23%	0.00%	NA
Indica I	595	88.20%	7.40%	4.37%	0.00%	NA
Indica II	465	12.00%	87.70%	0.22%	0.00%	NA
Indica III	913	64.10%	35.30%	0.66%	0.00%	NA
Indica Intermediate	786	61.20%	36.90%	1.91%	0.00%	NA
Temperate Japonica	767	2.70%	95.80%	1.43%	0.00%	NA
Tropical Japonica	504	55.00%	41.50%	3.57%	0.00%	NA
Japonica Intermediate	241	27.80%	68.90%	3.32%	0.00%	NA
VI/Aromatic	96	90.60%	7.30%	2.08%	0.00%	NA
Intermediate	90	48.90%	48.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0423367176	T -> A	LOC_Os04g39280.2	splice_region_variant ; LOW	silent_mutation	Average:54.319; most accessible tissue: Callus, score: 84.618	N	N	N	N
vg0423367176	T -> A	LOC_Os04g39280.2	3_prime_UTR_variant ; 258.0bp to feature; MODIFIER	silent_mutation	Average:54.319; most accessible tissue: Callus, score: 84.618	N	N	N	N
vg0423367176	T -> A	LOC_Os04g39270.1	upstream_gene_variant ; 1464.0bp to feature; MODIFIER	silent_mutation	Average:54.319; most accessible tissue: Callus, score: 84.618	N	N	N	N
vg0423367176	T -> A	LOC_Os04g39280.1	downstream_gene_variant ; 70.0bp to feature; MODIFIER	silent_mutation	Average:54.319; most accessible tissue: Callus, score: 84.618	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0423367176	NA	1.42E-10	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0423367176	NA	6.50E-07	mr1169	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176	NA	2.89E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176	NA	9.41E-06	mr1257	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176	NA	1.83E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176	NA	3.39E-11	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176	NA	8.17E-06	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176	NA	3.86E-08	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176	NA	1.79E-12	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176	NA	1.16E-06	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176	NA	8.76E-07	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176	NA	3.64E-09	mr1902_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176	NA	1.78E-08	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176	NA	3.48E-06	mr1928_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176	NA	1.42E-06	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176	NA	4.33E-17	mr1942_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176	NA	4.23E-07	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251