\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423367176:

Variant ID: vg0423367176 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23367176
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


GTATATTTTAAGTTAAGAAGAGTACTGAATTGCTGCTAGTATTCTTTTCAAATTCCTGAAAGAGTTGTTCTATTAGGGTTCCAGATTGGGAGAGAGGAAA[T/A]
TCTGTTTATGCCAGTTGATAATTTTAATAAAATCAATTAAAAGTTTTATGTGATACATATAATTCATTTGATTAAACTAAAATAAATCATCTGGCATTAC

Reverse complement sequence

GTAATGCCAGATGATTTATTTTAGTTTAATCAAATGAATTATATGTATCACATAAAACTTTTAATTGATTTTATTAAAATTATCAACTGGCATAAACAGA[A/T]
TTTCCTCTCTCCCAATCTGGAACCCTAATAGAACAACTCTTTCAGGAATTTGAAAAGAATACTAGCAGCAATTCAGTACTCTTCTTAACTTAAAATATAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 47.60% 2.01% 0.00% NA
All Indica  2759 59.70% 38.60% 1.74% 0.00% NA
All Japonica  1512 24.10% 73.40% 2.45% 0.00% NA
Aus  269 89.20% 8.60% 2.23% 0.00% NA
Indica I  595 88.20% 7.40% 4.37% 0.00% NA
Indica II  465 12.00% 87.70% 0.22% 0.00% NA
Indica III  913 64.10% 35.30% 0.66% 0.00% NA
Indica Intermediate  786 61.20% 36.90% 1.91% 0.00% NA
Temperate Japonica  767 2.70% 95.80% 1.43% 0.00% NA
Tropical Japonica  504 55.00% 41.50% 3.57% 0.00% NA
Japonica Intermediate  241 27.80% 68.90% 3.32% 0.00% NA
VI/Aromatic  96 90.60% 7.30% 2.08% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423367176 T -> A LOC_Os04g39280.2 splice_region_variant ; LOW silent_mutation Average:54.319; most accessible tissue: Callus, score: 84.618 N N N N
vg0423367176 T -> A LOC_Os04g39280.2 3_prime_UTR_variant ; 258.0bp to feature; MODIFIER silent_mutation Average:54.319; most accessible tissue: Callus, score: 84.618 N N N N
vg0423367176 T -> A LOC_Os04g39270.1 upstream_gene_variant ; 1464.0bp to feature; MODIFIER silent_mutation Average:54.319; most accessible tissue: Callus, score: 84.618 N N N N
vg0423367176 T -> A LOC_Os04g39280.1 downstream_gene_variant ; 70.0bp to feature; MODIFIER silent_mutation Average:54.319; most accessible tissue: Callus, score: 84.618 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423367176 NA 1.42E-10 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0423367176 NA 6.50E-07 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176 NA 2.89E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176 NA 9.41E-06 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176 NA 1.83E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176 NA 3.39E-11 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176 NA 8.17E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176 NA 3.86E-08 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176 NA 1.79E-12 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176 NA 1.16E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176 NA 8.76E-07 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176 NA 3.64E-09 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176 NA 1.78E-08 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176 NA 3.48E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176 NA 1.42E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176 NA 4.33E-17 mr1942_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423367176 NA 4.23E-07 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251