Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0423266856:

Variant ID: vg0423266856 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23266856
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


TATTAAATATCTATTGGTTTCTTTCCATGGATTATATGGATGGGTAGCACTATGGGAACGATGTCATTATTAGTTTAATCTATAACTGCCTGACGTGGAT[G/A]
TCTATATTTATAGGAGAGACTCTACCAAAATTTCTAATTATTTTGGGAGTTAGTAGTTTTGAGAGTATTTTGATGTGGCACTCTAGGTACGTGGTTACCT

Reverse complement sequence

AGGTAACCACGTACCTAGAGTGCCACATCAAAATACTCTCAAAACTACTAACTCCCAAAATAATTAGAAATTTTGGTAGAGTCTCTCCTATAAATATAGA[C/T]
ATCCACGTCAGGCAGTTATAGATTAAACTAATAATGACATCGTTCCCATAGTGCTACCCATCCATATAATCCATGGAAAGAAACCAATAGATATTTAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 10.60% 0.04% 0.00% NA
All Indica  2759 82.00% 17.90% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 33.80% 65.90% 0.34% 0.00% NA
Indica II  465 95.50% 4.50% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 89.70% 10.30% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423266856 G -> A LOC_Os04g39120.1 downstream_gene_variant ; 2683.0bp to feature; MODIFIER silent_mutation Average:30.646; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0423266856 G -> A LOC_Os04g39110-LOC_Os04g39120 intergenic_region ; MODIFIER silent_mutation Average:30.646; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423266856 NA 2.43E-12 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0423266856 NA 3.51E-09 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423266856 NA 2.69E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423266856 NA 7.89E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423266856 NA 4.37E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423266856 8.90E-07 1.26E-08 mr1691 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423266856 NA 8.23E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423266856 NA 7.69E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423266856 NA 1.30E-10 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423266856 NA 1.05E-06 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251