Variant ID: vg0423266856 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 23266856 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )
TATTAAATATCTATTGGTTTCTTTCCATGGATTATATGGATGGGTAGCACTATGGGAACGATGTCATTATTAGTTTAATCTATAACTGCCTGACGTGGAT[G/A]
TCTATATTTATAGGAGAGACTCTACCAAAATTTCTAATTATTTTGGGAGTTAGTAGTTTTGAGAGTATTTTGATGTGGCACTCTAGGTACGTGGTTACCT
AGGTAACCACGTACCTAGAGTGCCACATCAAAATACTCTCAAAACTACTAACTCCCAAAATAATTAGAAATTTTGGTAGAGTCTCTCCTATAAATATAGA[C/T]
ATCCACGTCAGGCAGTTATAGATTAAACTAATAATGACATCGTTCCCATAGTGCTACCCATCCATATAATCCATGGAAAGAAACCAATAGATATTTAATA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 89.40% | 10.60% | 0.04% | 0.00% | NA |
All Indica | 2759 | 82.00% | 17.90% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 33.80% | 65.90% | 0.34% | 0.00% | NA |
Indica II | 465 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 89.70% | 10.30% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0423266856 | G -> A | LOC_Os04g39120.1 | downstream_gene_variant ; 2683.0bp to feature; MODIFIER | silent_mutation | Average:30.646; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
vg0423266856 | G -> A | LOC_Os04g39110-LOC_Os04g39120 | intergenic_region ; MODIFIER | silent_mutation | Average:30.646; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0423266856 | NA | 2.43E-12 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0423266856 | NA | 3.51E-09 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423266856 | NA | 2.69E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423266856 | NA | 7.89E-13 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423266856 | NA | 4.37E-06 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423266856 | 8.90E-07 | 1.26E-08 | mr1691 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423266856 | NA | 8.23E-06 | mr1693 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423266856 | NA | 7.69E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423266856 | NA | 1.30E-10 | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423266856 | NA | 1.05E-06 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |