\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0423038839:

Variant ID: vg0423038839 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 23038839
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTGACTTTTTAATAAATGTTTGACCTTTCGTCTTATTAAAAAAAATGTAATTATCATTTATTTTATTATGACTTGATTTATCATCAAATGTTCTTTAA[A/G]
CATGACATAAATATTTTTATATTTGCACAAAAAAATTAAATAAGACGAATGGTCAAACGTTGATCAAAGAGTCAACGGCGTTATACATTAAAATACAGAG

Reverse complement sequence

CTCTGTATTTTAATGTATAACGCCGTTGACTCTTTGATCAACGTTTGACCATTCGTCTTATTTAATTTTTTTGTGCAAATATAAAAATATTTATGTCATG[T/C]
TTAAAGAACATTTGATGATAAATCAAGTCATAATAAAATAAATGATAATTACATTTTTTTTAATAAGACGAAAGGTCAAACATTTATTAAAAAGTCAAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.20% 13.80% 0.00% 0.00% NA
All Indica  2759 89.70% 10.30% 0.00% 0.00% NA
All Japonica  1512 92.10% 7.90% 0.00% 0.00% NA
Aus  269 17.50% 82.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 78.30% 21.70% 0.00% 0.00% NA
Indica Intermediate  786 90.30% 9.70% 0.00% 0.00% NA
Temperate Japonica  767 85.40% 14.60% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0423038839 A -> G LOC_Os04g38760.1 upstream_gene_variant ; 4887.0bp to feature; MODIFIER silent_mutation Average:40.639; most accessible tissue: Zhenshan97 root, score: 79.71 N N N N
vg0423038839 A -> G LOC_Os04g38770.1 upstream_gene_variant ; 1321.0bp to feature; MODIFIER silent_mutation Average:40.639; most accessible tissue: Zhenshan97 root, score: 79.71 N N N N
vg0423038839 A -> G LOC_Os04g38760-LOC_Os04g38770 intergenic_region ; MODIFIER silent_mutation Average:40.639; most accessible tissue: Zhenshan97 root, score: 79.71 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0423038839 NA 3.57E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 9.58E-08 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 4.76E-06 1.25E-21 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 7.47E-08 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 7.04E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 9.45E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 2.32E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 5.54E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 1.95E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 4.39E-18 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 2.58E-06 3.21E-08 mr1559 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 1.43E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 9.59E-06 5.44E-26 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 6.96E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 6.14E-15 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 1.66E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 8.39E-06 1.46E-18 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 1.20E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 3.18E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 1.44E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 3.16E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 4.32E-15 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 1.16E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 1.11E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 2.57E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 5.10E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0423038839 NA 2.97E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251