Variant ID: vg0423007797 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 23007797 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCAAATAAAAAAAATAAAACCCTCCTCTCCACACCGGTCCCCATGTCACGCCCCAAACTAGTCCCGACCGGAACTAGCCCGTGACGCTCCAAATTAACCT[A/G]
TTAATCGATACCAGTCCCAGAAAACAGTGCTGGTATCACAGGAAGACAGATTATCACAGCAACAGAGGTCTCTTTATTATAGAGTAGGAGTACAATCAAG
CTTGATTGTACTCCTACTCTATAATAAAGAGACCTCTGTTGCTGTGATAATCTGTCTTCCTGTGATACCAGCACTGTTTTCTGGGACTGGTATCGATTAA[T/C]
AGGTTAATTTGGAGCGTCACGGGCTAGTTCCGGTCGGGACTAGTTTGGGGCGTGACATGGGGACCGGTGTGGAGAGGAGGGTTTTATTTTTTTTATTTGA
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 87.10% | 2.90% | 8.32% | 1.65% | NA |
All Indica | 2759 | 88.50% | 0.40% | 9.64% | 1.52% | NA |
All Japonica | 1512 | 93.30% | 6.60% | 0.07% | 0.07% | NA |
Aus | 269 | 41.60% | 1.90% | 44.98% | 11.52% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 97.60% | 0.00% | 1.94% | 0.43% | NA |
Indica III | 913 | 76.20% | 0.90% | 21.36% | 1.53% | NA |
Indica Intermediate | 786 | 88.50% | 0.30% | 7.89% | 3.31% | NA |
Temperate Japonica | 767 | 87.60% | 12.30% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 99.40% | 0.40% | 0.00% | 0.20% | NA |
Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 76.00% | 20.80% | 2.08% | 1.04% | NA |
Intermediate | 90 | 91.10% | 2.20% | 3.33% | 3.33% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0423007797 | A -> DEL | N | N | silent_mutation | Average:51.002; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
vg0423007797 | A -> G | LOC_Os04g38730.1 | upstream_gene_variant ; 4255.0bp to feature; MODIFIER | silent_mutation | Average:51.002; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
vg0423007797 | A -> G | LOC_Os04g38730-LOC_Os04g38740 | intergenic_region ; MODIFIER | silent_mutation | Average:51.002; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0423007797 | 1.74E-07 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423007797 | NA | 1.87E-08 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423007797 | NA | 8.18E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423007797 | NA | 3.96E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423007797 | 6.72E-08 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423007797 | NA | 1.08E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423007797 | 3.39E-07 | NA | mr1765 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423007797 | NA | 3.65E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423007797 | NA | 1.31E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423007797 | NA | 5.12E-08 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0423007797 | NA | 1.50E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |