\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0422769578:

Variant ID: vg0422769578 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 22769578
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


ACTAGACATCGTTCACCCTGAACTTTTAATACCAGACGAATTCCCCTCCCCAAAGTTCCAGCGCCACCGTGTTCGCCGCCCTCACCGTCGGCTAGGGATT[C/T]
GATTGGAGAATTTTCAGAATATGCCATTCGATTTGCACCACTTTCAATATTTGTCACTCAATTCGCAATACTTTCAGAACATGCTACCGAGGACATGAAT

Reverse complement sequence

ATTCATGTCCTCGGTAGCATGTTCTGAAAGTATTGCGAATTGAGTGACAAATATTGAAAGTGGTGCAAATCGAATGGCATATTCTGAAAATTCTCCAATC[G/A]
AATCCCTAGCCGACGGTGAGGGCGGCGAACACGGTGGCGCTGGAACTTTGGGGAGGGGAATTCGTCTGGTATTAAAAGTTCAGGGTGAACGATGTCTAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.30% 9.60% 2.16% 16.99% NA
All Indica  2759 66.00% 7.10% 1.56% 25.34% NA
All Japonica  1512 90.50% 4.40% 3.44% 1.72% NA
Aus  269 6.30% 66.50% 1.49% 25.65% NA
Indica I  595 81.20% 0.00% 0.50% 18.32% NA
Indica II  465 75.30% 2.40% 1.51% 20.86% NA
Indica III  913 55.10% 10.80% 1.75% 32.31% NA
Indica Intermediate  786 61.80% 10.80% 2.16% 25.19% NA
Temperate Japonica  767 93.50% 6.30% 0.26% 0.00% NA
Tropical Japonica  504 81.90% 3.40% 9.52% 5.16% NA
Japonica Intermediate  241 98.80% 0.40% 0.83% 0.00% NA
VI/Aromatic  96 91.70% 6.20% 1.04% 1.04% NA
Intermediate  90 81.10% 7.80% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0422769578 C -> DEL N N silent_mutation Average:32.922; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg0422769578 C -> T LOC_Os04g38260.1 upstream_gene_variant ; 3402.0bp to feature; MODIFIER silent_mutation Average:32.922; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg0422769578 C -> T LOC_Os04g38270.1 downstream_gene_variant ; 3890.0bp to feature; MODIFIER silent_mutation Average:32.922; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg0422769578 C -> T LOC_Os04g38260-LOC_Os04g38270 intergenic_region ; MODIFIER silent_mutation Average:32.922; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0422769578 NA 1.27E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422769578 NA 3.32E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422769578 NA 4.03E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422769578 NA 2.65E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422769578 NA 2.23E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422769578 NA 8.47E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422769578 NA 1.28E-37 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422769578 NA 8.32E-08 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422769578 NA 5.46E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422769578 NA 1.53E-41 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422769578 4.77E-06 NA mr1403_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422769578 1.43E-06 1.26E-37 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422769578 4.92E-06 2.60E-44 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422769578 NA 2.27E-34 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251