\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0422730303:

Variant ID: vg0422730303 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 22730303
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGAGACGCACTGTCACTCTGTACCGAGGGCCGGAGCAACCGGTTGTTTTCTTTGCACCCCCAACCTCTGTCAATAGATCAGAACTGCATCAGATAGGA[C/G]
TGTCAGAAATCCCCATCGTCAGAGAGTTTGGAGACGTGTTCCCGGAAGAACTACCCGGTATGCCGCCCAAGCGAGAGATTGAGTTCCGGATAGATCTTGC

Reverse complement sequence

GCAAGATCTATCCGGAACTCAATCTCTCGCTTGGGCGGCATACCGGGTAGTTCTTCCGGGAACACGTCTCCAAACTCTCTGACGATGGGGATTTCTGACA[G/C]
TCCTATCTGATGCAGTTCTGATCTATTGACAGAGGTTGGGGGTGCAAAGAAAACAACCGGTTGCTCCGGCCCTCGGTACAGAGTGACAGTGCGTCTCGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.40% 4.80% 11.72% 52.03% NA
All Indica  2759 28.30% 7.90% 14.46% 49.37% NA
All Japonica  1512 42.40% 0.00% 4.23% 53.37% NA
Aus  269 5.60% 3.70% 20.45% 70.26% NA
Indica I  595 18.00% 16.60% 9.58% 55.80% NA
Indica II  465 25.60% 2.20% 9.03% 63.23% NA
Indica III  913 38.00% 7.70% 19.39% 34.94% NA
Indica Intermediate  786 26.50% 4.80% 15.65% 53.05% NA
Temperate Japonica  767 70.80% 0.00% 0.78% 28.42% NA
Tropical Japonica  504 4.60% 0.00% 9.92% 85.52% NA
Japonica Intermediate  241 31.10% 0.00% 3.32% 65.56% NA
VI/Aromatic  96 19.80% 0.00% 26.04% 54.17% NA
Intermediate  90 31.10% 2.20% 12.22% 54.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0422730303 C -> DEL LOC_Os04g38190.1 N frameshift_variant Average:20.689; most accessible tissue: Callus, score: 34.33 N N N N
vg0422730303 C -> G LOC_Os04g38190.1 missense_variant ; p.Leu851Val; MODERATE nonsynonymous_codon ; L851V Average:20.689; most accessible tissue: Callus, score: 34.33 possibly damaging 1.649 DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0422730303 NA 9.20E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 3.27E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 7.34E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 7.91E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 2.52E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 4.69E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 1.47E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 3.44E-07 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 1.44E-06 mr1482_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 1.10E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 5.10E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 8.15E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 3.30E-07 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 3.89E-07 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 5.47E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 3.63E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 1.09E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 1.85E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 1.10E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422730303 NA 1.47E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251