Variant ID: vg0422582211 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 22582211 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCTACAGGGATGCTACAGTAATCAGCCACTAATCATAGATTAATATATATCATTAGATTCGTCTCGCAAAATAGCCTAGGGGTTATGGAATCGGTTTTGT[C/T]
GGTAATCTATGTTTAATACTCCTAAATAGCAAGATTCCGGAGGGCTATTTAATAGTTCGGAGGATCCAAACAAGGCCATTGTTGATGTAGTACTCTGTAG
CTACAGAGTACTACATCAACAATGGCCTTGTTTGGATCCTCCGAACTATTAAATAGCCCTCCGGAATCTTGCTATTTAGGAGTATTAAACATAGATTACC[G/A]
ACAAAACCGATTCCATAACCCCTAGGCTATTTTGCGAGACGAATCTAATGATATATATTAATCTATGATTAGTGGCTGATTACTGTAGCATCCCTGTAGC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.50% | 3.80% | 1.67% | 0.00% | NA |
All Indica | 2759 | 90.70% | 6.40% | 2.86% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 94.10% | 0.20% | 5.71% | 0.00% | NA |
Indica II | 465 | 85.20% | 11.40% | 3.44% | 0.00% | NA |
Indica III | 913 | 92.20% | 7.10% | 0.66% | 0.00% | NA |
Indica Intermediate | 786 | 89.70% | 7.40% | 2.93% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0422582211 | C -> T | LOC_Os04g37960.1 | upstream_gene_variant ; 1245.0bp to feature; MODIFIER | silent_mutation | Average:61.294; most accessible tissue: Minghui63 flower, score: 81.696 | N | N | N | N |
vg0422582211 | C -> T | LOC_Os04g37950-LOC_Os04g37960 | intergenic_region ; MODIFIER | silent_mutation | Average:61.294; most accessible tissue: Minghui63 flower, score: 81.696 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0422582211 | 4.11E-07 | NA | mr1548 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0422582211 | 1.93E-06 | NA | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |