\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0422579943:

Variant ID: vg0422579943 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 22579943
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


GGGCCGCTAAGAAGCGTAATACCCTACTCCTGTGTTTGGGATTATGGTCGAGTGTAGAACACAAGTGCCTGGGGCTGCGAGACTCAAGCGCCAGTTCGCT[C/T]
GGAAGTCCCCCCTCCTCCACCACTAGGCCTGGACCTCCTTTTATACCTCAAGAGGTTACCACATGGGCCCAACAATCTAACTTAGCTCTGGTAGAGAAGT

Reverse complement sequence

ACTTCTCTACCAGAGCTAAGTTAGATTGTTGGGCCCATGTGGTAACCTCTTGAGGTATAAAAGGAGGTCCAGGCCTAGTGGTGGAGGAGGGGGGACTTCC[G/A]
AGCGAACTGGCGCTTGAGTCTCGCAGCCCCAGGCACTTGTGTTCTACACTCGACCATAATCCCAAACACAGGAGTAGGGTATTACGCTTCTTAGCGGCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 0.30% 6.05% 0.17% NA
All Indica  2759 95.60% 0.10% 4.20% 0.11% NA
All Japonica  1512 99.90% 0.00% 0.00% 0.07% NA
Aus  269 35.70% 3.70% 59.11% 1.49% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.30% 0.00% 1.51% 0.22% NA
Indica III  913 95.40% 0.10% 4.49% 0.00% NA
Indica Intermediate  786 90.80% 0.30% 8.65% 0.25% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 0.00% 6.25% 0.00% NA
Intermediate  90 94.40% 0.00% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0422579943 C -> DEL N N silent_mutation Average:42.284; most accessible tissue: Minghui63 young leaf, score: 61.887 N N N N
vg0422579943 C -> T LOC_Os04g37960.1 upstream_gene_variant ; 3513.0bp to feature; MODIFIER silent_mutation Average:42.284; most accessible tissue: Minghui63 young leaf, score: 61.887 N N N N
vg0422579943 C -> T LOC_Os04g37950-LOC_Os04g37960 intergenic_region ; MODIFIER silent_mutation Average:42.284; most accessible tissue: Minghui63 young leaf, score: 61.887 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0422579943 NA 7.79E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943 NA 9.56E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943 NA 3.94E-07 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943 NA 5.61E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943 NA 2.61E-11 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943 NA 5.76E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943 NA 9.45E-07 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943 NA 3.20E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943 NA 1.91E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943 NA 6.87E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943 NA 4.16E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943 NA 2.70E-08 mr1787 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943 NA 2.12E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943 NA 8.45E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251