Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0422579943:

Variant ID: vg0422579943 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 22579943
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

GGGCCGCTAAGAAGCGTAATACCCTACTCCTGTGTTTGGGATTATGGTCGAGTGTAGAACACAAGTGCCTGGGGCTGCGAGACTCAAGCGCCAGTTCGCT[C/T]
GGAAGTCCCCCCTCCTCCACCACTAGGCCTGGACCTCCTTTTATACCTCAAGAGGTTACCACATGGGCCCAACAATCTAACTTAGCTCTGGTAGAGAAGT

Reverse complement sequence

ACTTCTCTACCAGAGCTAAGTTAGATTGTTGGGCCCATGTGGTAACCTCTTGAGGTATAAAAGGAGGTCCAGGCCTAGTGGTGGAGGAGGGGGGACTTCC[G/A]
AGCGAACTGGCGCTTGAGTCTCGCAGCCCCAGGCACTTGTGTTCTACACTCGACCATAATCCCAAACACAGGAGTAGGGTATTACGCTTCTTAGCGGCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.50%	0.30%	6.05%	0.17%	NA
All Indica	2759	95.60%	0.10%	4.20%	0.11%	NA
All Japonica	1512	99.90%	0.00%	0.00%	0.07%	NA
Aus	269	35.70%	3.70%	59.11%	1.49%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.30%	0.00%	1.51%	0.22%	NA
Indica III	913	95.40%	0.10%	4.49%	0.00%	NA
Indica Intermediate	786	90.80%	0.30%	8.65%	0.25%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	0.00%	6.25%	0.00%	NA
Intermediate	90	94.40%	0.00%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0422579943	C -> DEL	N	N	silent_mutation	Average:42.284; most accessible tissue: Minghui63 young leaf, score: 61.887	N	N	N	N
vg0422579943	C -> T	LOC_Os04g37960.1	upstream_gene_variant ; 3513.0bp to feature; MODIFIER	silent_mutation	Average:42.284; most accessible tissue: Minghui63 young leaf, score: 61.887	N	N	N	N
vg0422579943	C -> T	LOC_Os04g37950-LOC_Os04g37960	intergenic_region ; MODIFIER	silent_mutation	Average:42.284; most accessible tissue: Minghui63 young leaf, score: 61.887	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0422579943	NA	7.79E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943	NA	9.56E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943	NA	3.94E-07	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943	NA	5.61E-07	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943	NA	2.61E-11	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943	NA	5.76E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943	NA	9.45E-07	mr1393	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943	NA	3.20E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943	NA	1.91E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943	NA	6.87E-07	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943	NA	4.16E-06	mr1759	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943	NA	2.70E-08	mr1787	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943	NA	2.12E-06	mr1820	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422579943	NA	8.45E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251