\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0422562393:

Variant ID: vg0422562393 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 22562393
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAAGTACTCTAGATATTTCAGGAGTAATTTTTAAGCAGAATTATTTCGGGGCTGTTCAGATTGTAGCCAAAATAAATTGCCAAAATTTTGGCAAGTTG[G/A]
CAATATTACCAAAAATTTGGCAAGATTTCTTATGCATTGTCCAAAGTTTAACAACAAACTAAATGCATGCACTTTTGGCAACTTAGCCGAAAAAATGGCA

Reverse complement sequence

TGCCATTTTTTCGGCTAAGTTGCCAAAAGTGCATGCATTTAGTTTGTTGTTAAACTTTGGACAATGCATAAGAAATCTTGCCAAATTTTTGGTAATATTG[C/T]
CAACTTGCCAAAATTTTGGCAATTTATTTTGGCTACAATCTGAACAGCCCCGAAATAATTCTGCTTAAAAATTACTCCTGAAATATCTAGAGTACTTTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.00% 21.30% 0.72% 20.91% NA
All Indica  2759 58.60% 7.90% 0.94% 32.55% NA
All Japonica  1512 61.70% 38.20% 0.07% 0.07% NA
Aus  269 0.40% 69.50% 1.12% 29.00% NA
Indica I  595 76.30% 1.30% 0.50% 21.85% NA
Indica II  465 71.20% 2.60% 0.22% 26.02% NA
Indica III  913 46.00% 9.30% 0.55% 44.14% NA
Indica Intermediate  786 52.50% 14.20% 2.16% 31.04% NA
Temperate Japonica  767 32.50% 67.50% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 2.00% 0.20% 0.20% NA
Japonica Intermediate  241 79.70% 20.30% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 11.50% 1.04% 4.17% NA
Intermediate  90 70.00% 18.90% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0422562393 G -> DEL N N silent_mutation Average:24.26; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N
vg0422562393 G -> A LOC_Os04g37930.1 upstream_gene_variant ; 2770.0bp to feature; MODIFIER silent_mutation Average:24.26; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N
vg0422562393 G -> A LOC_Os04g37940.1 downstream_gene_variant ; 515.0bp to feature; MODIFIER silent_mutation Average:24.26; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N
vg0422562393 G -> A LOC_Os04g37950.1 downstream_gene_variant ; 4925.0bp to feature; MODIFIER silent_mutation Average:24.26; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N
vg0422562393 G -> A LOC_Os04g37930-LOC_Os04g37940 intergenic_region ; MODIFIER silent_mutation Average:24.26; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0422562393 NA 9.80E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 9.18E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 1.44E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 3.57E-08 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 1.76E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 8.04E-15 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 4.13E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 7.13E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 4.81E-09 mr1596 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 4.67E-25 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 3.58E-14 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 4.11E-10 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 1.55E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 7.11E-08 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 4.00E-23 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 3.07E-07 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 1.45E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 8.05E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 7.96E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 2.69E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 5.29E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 2.41E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 6.22E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 3.62E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393 NA 6.45E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251