Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0422562393:

Variant ID: vg0422562393 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 22562393
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAAGTACTCTAGATATTTCAGGAGTAATTTTTAAGCAGAATTATTTCGGGGCTGTTCAGATTGTAGCCAAAATAAATTGCCAAAATTTTGGCAAGTTG[G/A]
CAATATTACCAAAAATTTGGCAAGATTTCTTATGCATTGTCCAAAGTTTAACAACAAACTAAATGCATGCACTTTTGGCAACTTAGCCGAAAAAATGGCA

Reverse complement sequence

TGCCATTTTTTCGGCTAAGTTGCCAAAAGTGCATGCATTTAGTTTGTTGTTAAACTTTGGACAATGCATAAGAAATCTTGCCAAATTTTTGGTAATATTG[C/T]
CAACTTGCCAAAATTTTGGCAATTTATTTTGGCTACAATCTGAACAGCCCCGAAATAATTCTGCTTAAAAATTACTCCTGAAATATCTAGAGTACTTTTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.00%	21.30%	0.72%	20.91%	NA
All Indica	2759	58.60%	7.90%	0.94%	32.55%	NA
All Japonica	1512	61.70%	38.20%	0.07%	0.07%	NA
Aus	269	0.40%	69.50%	1.12%	29.00%	NA
Indica I	595	76.30%	1.30%	0.50%	21.85%	NA
Indica II	465	71.20%	2.60%	0.22%	26.02%	NA
Indica III	913	46.00%	9.30%	0.55%	44.14%	NA
Indica Intermediate	786	52.50%	14.20%	2.16%	31.04%	NA
Temperate Japonica	767	32.50%	67.50%	0.00%	0.00%	NA
Tropical Japonica	504	97.60%	2.00%	0.20%	0.20%	NA
Japonica Intermediate	241	79.70%	20.30%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	11.50%	1.04%	4.17%	NA
Intermediate	90	70.00%	18.90%	3.33%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0422562393	G -> DEL	N	N	silent_mutation	Average:24.26; most accessible tissue: Zhenshan97 flower, score: 52.192	N	N	N	N
vg0422562393	G -> A	LOC_Os04g37930.1	upstream_gene_variant ; 2770.0bp to feature; MODIFIER	silent_mutation	Average:24.26; most accessible tissue: Zhenshan97 flower, score: 52.192	N	N	N	N
vg0422562393	G -> A	LOC_Os04g37940.1	downstream_gene_variant ; 515.0bp to feature; MODIFIER	silent_mutation	Average:24.26; most accessible tissue: Zhenshan97 flower, score: 52.192	N	N	N	N
vg0422562393	G -> A	LOC_Os04g37950.1	downstream_gene_variant ; 4925.0bp to feature; MODIFIER	silent_mutation	Average:24.26; most accessible tissue: Zhenshan97 flower, score: 52.192	N	N	N	N
vg0422562393	G -> A	LOC_Os04g37930-LOC_Os04g37940	intergenic_region ; MODIFIER	silent_mutation	Average:24.26; most accessible tissue: Zhenshan97 flower, score: 52.192	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0422562393	NA	9.80E-09	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	9.18E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	1.44E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	3.57E-08	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	1.76E-08	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	8.04E-15	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	4.13E-06	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	7.13E-06	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	4.81E-09	mr1596	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	4.67E-25	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	3.58E-14	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	4.11E-10	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	1.55E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	7.11E-08	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	4.00E-23	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	3.07E-07	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	1.45E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	8.05E-07	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	7.96E-09	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	2.69E-13	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	5.29E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	2.41E-06	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	6.22E-07	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	3.62E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422562393	NA	6.45E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251