\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0422509978:

Variant ID: vg0422509978 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 22509978
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAGCGCCGTATGCTAGTGCCTCAACAGAAATTAGTGGTATGCTCCATGCCTCCATTCTCTCCCTAAGTCTCTAAATTATTTGAATTCGAAATAAGTC[C/A]
TTTTCGATTAATCGTTAATTTGCCTTTTTTTTCTTTGTACAGATTACTACTAATGAAGAATAATAAATGATTGGCAGTAAAACATCATCTATTGGACATT

Reverse complement sequence

AATGTCCAATAGATGATGTTTTACTGCCAATCATTTATTATTCTTCATTAGTAGTAATCTGTACAAAGAAAAAAAAGGCAAATTAACGATTAATCGAAAA[G/T]
GACTTATTTCGAATTCAAATAATTTAGAGACTTAGGGAGAGAATGGAGGCATGGAGCATACCACTAATTTCTGTTGAGGCACTAGCATACGGCGCTTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.90% 21.50% 6.05% 38.60% NA
All Indica  2759 8.20% 35.60% 8.19% 48.10% NA
All Japonica  1512 82.90% 1.00% 2.84% 13.23% NA
Aus  269 4.10% 0.40% 0.37% 95.17% NA
Indica I  595 10.90% 28.90% 10.92% 49.24% NA
Indica II  465 4.30% 26.50% 6.02% 63.23% NA
Indica III  913 5.00% 50.60% 6.46% 37.90% NA
Indica Intermediate  786 12.00% 28.50% 9.41% 50.13% NA
Temperate Japonica  767 79.10% 0.50% 2.35% 17.99% NA
Tropical Japonica  504 88.90% 1.00% 2.78% 7.34% NA
Japonica Intermediate  241 82.60% 2.50% 4.56% 10.37% NA
VI/Aromatic  96 81.20% 4.20% 3.12% 11.46% NA
Intermediate  90 35.60% 16.70% 14.44% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0422509978 C -> DEL N N silent_mutation Average:25.765; most accessible tissue: Callus, score: 78.653 N N N N
vg0422509978 C -> A LOC_Os04g37840-LOC_Os04g37850 intergenic_region ; MODIFIER silent_mutation Average:25.765; most accessible tissue: Callus, score: 78.653 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0422509978 2.85E-06 2.32E-07 mr1538 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422509978 7.76E-11 2.15E-12 mr1547 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422509978 9.90E-09 1.76E-10 mr1547 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422509978 9.58E-12 6.11E-15 mr1709 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422509978 9.44E-10 4.95E-18 mr1709 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422509978 NA 7.64E-07 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422509978 3.94E-06 6.72E-08 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422509978 8.66E-07 8.44E-09 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422509978 2.79E-14 1.65E-23 mr1709_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422509978 1.81E-10 4.45E-23 mr1709_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251