\
| Variant ID: vg0422509978 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 22509978 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 186. )
AAAAAGCGCCGTATGCTAGTGCCTCAACAGAAATTAGTGGTATGCTCCATGCCTCCATTCTCTCCCTAAGTCTCTAAATTATTTGAATTCGAAATAAGTC[C/A]
TTTTCGATTAATCGTTAATTTGCCTTTTTTTTCTTTGTACAGATTACTACTAATGAAGAATAATAAATGATTGGCAGTAAAACATCATCTATTGGACATT
AATGTCCAATAGATGATGTTTTACTGCCAATCATTTATTATTCTTCATTAGTAGTAATCTGTACAAAGAAAAAAAAGGCAAATTAACGATTAATCGAAAA[G/T]
GACTTATTTCGAATTCAAATAATTTAGAGACTTAGGGAGAGAATGGAGGCATGGAGCATACCACTAATTTCTGTTGAGGCACTAGCATACGGCGCTTTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.90% | 21.50% | 6.05% | 38.60% | NA |
| All Indica | 2759 | 8.20% | 35.60% | 8.19% | 48.10% | NA |
| All Japonica | 1512 | 82.90% | 1.00% | 2.84% | 13.23% | NA |
| Aus | 269 | 4.10% | 0.40% | 0.37% | 95.17% | NA |
| Indica I | 595 | 10.90% | 28.90% | 10.92% | 49.24% | NA |
| Indica II | 465 | 4.30% | 26.50% | 6.02% | 63.23% | NA |
| Indica III | 913 | 5.00% | 50.60% | 6.46% | 37.90% | NA |
| Indica Intermediate | 786 | 12.00% | 28.50% | 9.41% | 50.13% | NA |
| Temperate Japonica | 767 | 79.10% | 0.50% | 2.35% | 17.99% | NA |
| Tropical Japonica | 504 | 88.90% | 1.00% | 2.78% | 7.34% | NA |
| Japonica Intermediate | 241 | 82.60% | 2.50% | 4.56% | 10.37% | NA |
| VI/Aromatic | 96 | 81.20% | 4.20% | 3.12% | 11.46% | NA |
| Intermediate | 90 | 35.60% | 16.70% | 14.44% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0422509978 | C -> DEL | N | N | silent_mutation | Average:25.765; most accessible tissue: Callus, score: 78.653 | N | N | N | N |
| vg0422509978 | C -> A | LOC_Os04g37840-LOC_Os04g37850 | intergenic_region ; MODIFIER | silent_mutation | Average:25.765; most accessible tissue: Callus, score: 78.653 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0422509978 | 2.85E-06 | 2.32E-07 | mr1538 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422509978 | 7.76E-11 | 2.15E-12 | mr1547 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422509978 | 9.90E-09 | 1.76E-10 | mr1547 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422509978 | 9.58E-12 | 6.11E-15 | mr1709 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422509978 | 9.44E-10 | 4.95E-18 | mr1709 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422509978 | NA | 7.64E-07 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422509978 | 3.94E-06 | 6.72E-08 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422509978 | 8.66E-07 | 8.44E-09 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422509978 | 2.79E-14 | 1.65E-23 | mr1709_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0422509978 | 1.81E-10 | 4.45E-23 | mr1709_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |