Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0422276479:

Variant ID: vg0422276479 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 22276479
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAACTTTTTTCTACGTCATCTTGCGTGCTGAATAATTGTCTCGGTTTTTGCACCATGCTAAGTCTCGTTGACCACTATTATCGTAGATAATTGGTCAA[G/A]
CCTACCCGTTACATTTGGTATTGACATTCTCTGGGTCAACCGTGAAACTGCCGCCCTCTCATCCGTTCATACTTCATACTAGTTGACTGGGAATTGCTTG

Reverse complement sequence

CAAGCAATTCCCAGTCAACTAGTATGAAGTATGAACGGATGAGAGGGCGGCAGTTTCACGGTTGACCCAGAGAATGTCAATACCAAATGTAACGGGTAGG[C/T]
TTGACCAATTATCTACGATAATAGTGGTCAACGAGACTTAGCATGGTGCAAAAACCGAGACAATTATTCAGCACGCAAGATGACGTAGAAAAAAGTTTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.10% 1.90% 0.08% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 94.20% 5.60% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 98.20% 1.70% 0.13% 0.00% NA
Tropical Japonica  504 87.50% 12.30% 0.20% 0.00% NA
Japonica Intermediate  241 95.40% 3.70% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0422276479 G -> A LOC_Os04g36910.1 upstream_gene_variant ; 4144.0bp to feature; MODIFIER silent_mutation Average:87.186; most accessible tissue: Minghui63 root, score: 97.516 N N N N
vg0422276479 G -> A LOC_Os04g36910.2 upstream_gene_variant ; 4144.0bp to feature; MODIFIER silent_mutation Average:87.186; most accessible tissue: Minghui63 root, score: 97.516 N N N N
vg0422276479 G -> A LOC_Os04g36910-LOC_Os04g37410 intergenic_region ; MODIFIER silent_mutation Average:87.186; most accessible tissue: Minghui63 root, score: 97.516 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0422276479 G A -0.15 -0.06 -0.06 -0.04 -0.07 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0422276479 8.49E-07 NA mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 1.69E-06 1.69E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 NA 4.74E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 NA 6.45E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 NA 2.04E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 3.62E-06 1.59E-07 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 NA 6.09E-09 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 NA 3.02E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 7.58E-06 NA mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 NA 4.46E-10 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 2.82E-06 2.82E-06 mr1264 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 6.84E-07 NA mr1408 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 3.74E-06 2.34E-07 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 NA 1.93E-06 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 9.17E-06 NA mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 NA 7.38E-09 mr1620 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 NA 2.29E-06 mr1654 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 NA 2.45E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 NA 8.62E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 3.70E-06 NA mr1949 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 NA 2.25E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 NA 6.66E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422276479 NA 2.68E-06 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251