\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0422013922:

Variant ID: vg0422013922 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 22013922
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTTCATTTTCTGGTTTCTACAACTACAGCTTCTCAGAATTTAGATAAAAACTGTGCTGCTTAGAGGAGCTTCCGATTCTGAAAGAAGCTGTAGCAGTT[G/A]
AAAGCTCTCCTAAACAAGGCTCTAGTTAGGAATGGGGCATTGTCTAGTCCATGATTAGGTTGGTTTTTTTTTTAAAGGACGGATGGAGTTCACAGTTGCA

Reverse complement sequence

TGCAACTGTGAACTCCATCCGTCCTTTAAAAAAAAAACCAACCTAATCATGGACTAGACAATGCCCCATTCCTAACTAGAGCCTTGTTTAGGAGAGCTTT[C/T]
AACTGCTACAGCTTCTTTCAGAATCGGAAGCTCCTCTAAGCAGCACAGTTTTTATCTAAATTCTGAGAAGCTGTAGTTGTAGAAACCAGAAAATGAACTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 15.30% 0.13% 0.00% NA
All Indica  2759 95.20% 4.70% 0.07% 0.00% NA
All Japonica  1512 75.90% 23.80% 0.26% 0.00% NA
Aus  269 34.60% 65.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 96.10% 3.70% 0.22% 0.00% NA
Indica III  913 92.10% 7.90% 0.00% 0.00% NA
Indica Intermediate  786 94.80% 5.20% 0.00% 0.00% NA
Temperate Japonica  767 97.70% 2.10% 0.26% 0.00% NA
Tropical Japonica  504 36.50% 63.30% 0.20% 0.00% NA
Japonica Intermediate  241 89.20% 10.40% 0.41% 0.00% NA
VI/Aromatic  96 67.70% 32.30% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0422013922 G -> A LOC_Os04g36058.1 upstream_gene_variant ; 189.0bp to feature; MODIFIER silent_mutation Average:96.474; most accessible tissue: Minghui63 flower, score: 98.482 N N N N
vg0422013922 G -> A LOC_Os04g36062.1 upstream_gene_variant ; 3942.0bp to feature; MODIFIER silent_mutation Average:96.474; most accessible tissue: Minghui63 flower, score: 98.482 N N N N
vg0422013922 G -> A LOC_Os04g36058.2 upstream_gene_variant ; 189.0bp to feature; MODIFIER silent_mutation Average:96.474; most accessible tissue: Minghui63 flower, score: 98.482 N N N N
vg0422013922 G -> A LOC_Os04g36062.2 upstream_gene_variant ; 3939.0bp to feature; MODIFIER silent_mutation Average:96.474; most accessible tissue: Minghui63 flower, score: 98.482 N N N N
vg0422013922 G -> A LOC_Os04g36054.1 downstream_gene_variant ; 1899.0bp to feature; MODIFIER silent_mutation Average:96.474; most accessible tissue: Minghui63 flower, score: 98.482 N N N N
vg0422013922 G -> A LOC_Os04g36054-LOC_Os04g36058 intergenic_region ; MODIFIER silent_mutation Average:96.474; most accessible tissue: Minghui63 flower, score: 98.482 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0422013922 G A -0.11 -0.06 -0.02 -0.04 -0.06 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0422013922 NA 7.03E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 6.67E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 4.62E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 8.43E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 8.30E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 2.42E-12 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 7.30E-16 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 2.44E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 6.49E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 4.82E-09 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 2.06E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 3.55E-12 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 3.77E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 1.52E-06 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 7.96E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 8.49E-07 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 1.04E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 1.40E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 5.69E-14 mr1471_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 9.70E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 3.70E-17 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 1.49E-15 mr1642_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 2.97E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 5.02E-10 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 2.55E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 3.14E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 4.74E-09 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 2.54E-08 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 6.09E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 4.88E-12 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0422013922 NA 2.10E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251