\
| Variant ID: vg0421968989 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21968989 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGGGTTCCGATCAACAATTTAATTTAGCACATAGAATCCACATATAAATCTTAGACTTTTGGAAAAAAAACCAAAAAATAAAATAGGTGTTAGCAGGGG[C/T]
GGATCCAACGTGAGTGCAGGGGGGACTCGAGTCCCCCCACACCCACAAGACCCATGGATACCCCCCGGAGCACCCCCTTTATTTTTTTTCACCATGAATG
CATTCATGGTGAAAAAAAATAAAGGGGGTGCTCCGGGGGGTATCCATGGGTCTTGTGGGTGTGGGGGGACTCGAGTCCCCCCTGCACTCACGTTGGATCC[G/A]
CCCCTGCTAACACCTATTTTATTTTTTGGTTTTTTTTCCAAAAGTCTAAGATTTATATGTGGATTCTATGTGCTAAATTAAATTGTTGATCGGAACCCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.80% | 4.40% | 0.80% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.50% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 85.70% | 12.20% | 2.12% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.70% | 2.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 65.50% | 29.80% | 4.76% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.00% | 7.50% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421968989 | C -> T | LOC_Os04g36020.1 | upstream_gene_variant ; 3098.0bp to feature; MODIFIER | silent_mutation | Average:41.759; most accessible tissue: Minghui63 root, score: 58.187 | N | N | N | N |
| vg0421968989 | C -> T | LOC_Os04g36040.1 | downstream_gene_variant ; 1797.0bp to feature; MODIFIER | silent_mutation | Average:41.759; most accessible tissue: Minghui63 root, score: 58.187 | N | N | N | N |
| vg0421968989 | C -> T | LOC_Os04g36030.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.759; most accessible tissue: Minghui63 root, score: 58.187 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421968989 | NA | 1.27E-06 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421968989 | NA | 5.65E-09 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421968989 | NA | 2.17E-06 | mr1224 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421968989 | NA | 6.20E-06 | mr1225 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421968989 | NA | 3.80E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421968989 | NA | 5.71E-06 | mr1246 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421968989 | NA | 2.06E-07 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421968989 | 3.21E-06 | NA | mr1560 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421968989 | NA | 1.36E-06 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |