\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421939437:

Variant ID: vg0421939437 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21939437
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGCGGGGCCGAGCGGCAGCGTAGCGCAGGCGCTGACGGTGGCGGCGACCGGGCGGTCGGTCACGAGCGCGCGCGCGCGAGGGAACGAGCGGCATAGCC[G/A]
AAAATCGAATGGCGGCAGCGGGAAATCGGCGATGGCGGCAGCGCTGGCGTGGGAGAGAGAGATCGAACGAGAGAGAGAGACAGCGAGAGAGAGGAAGAGG

Reverse complement sequence

CCTCTTCCTCTCTCTCGCTGTCTCTCTCTCTCGTTCGATCTCTCTCTCCCACGCCAGCGCTGCCGCCATCGCCGATTTCCCGCTGCCGCCATTCGATTTT[C/T]
GGCTATGCCGCTCGTTCCCTCGCGCGCGCGCGCTCGTGACCGACCGCCCGGTCGCCGCCACCGTCAGCGCCTGCGCTACGCTGCCGCTCGGCCCCGCTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.90% 14.50% 1.61% 0.00% NA
All Indica  2759 95.30% 3.80% 0.87% 0.00% NA
All Japonica  1512 74.50% 23.70% 1.79% 0.00% NA
Aus  269 32.70% 63.20% 4.09% 0.00% NA
Indica I  595 98.70% 0.20% 1.18% 0.00% NA
Indica II  465 97.60% 1.90% 0.43% 0.00% NA
Indica III  913 94.60% 5.30% 0.11% 0.00% NA
Indica Intermediate  786 92.10% 6.10% 1.78% 0.00% NA
Temperate Japonica  767 97.00% 2.00% 1.04% 0.00% NA
Tropical Japonica  504 34.70% 62.50% 2.78% 0.00% NA
Japonica Intermediate  241 85.90% 12.00% 2.07% 0.00% NA
VI/Aromatic  96 60.40% 30.20% 9.38% 0.00% NA
Intermediate  90 68.90% 25.60% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421939437 G -> A LOC_Os04g35980.1 downstream_gene_variant ; 265.0bp to feature; MODIFIER silent_mutation Average:55.31; most accessible tissue: Minghui63 flag leaf, score: 71.577 N N N N
vg0421939437 G -> A LOC_Os04g35990.1 downstream_gene_variant ; 2762.0bp to feature; MODIFIER silent_mutation Average:55.31; most accessible tissue: Minghui63 flag leaf, score: 71.577 N N N N
vg0421939437 G -> A LOC_Os04g35980-LOC_Os04g35990 intergenic_region ; MODIFIER silent_mutation Average:55.31; most accessible tissue: Minghui63 flag leaf, score: 71.577 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421939437 NA 3.57E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 4.79E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 8.20E-08 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 5.11E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 1.75E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 1.49E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 1.67E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 7.20E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 1.62E-06 mr1415_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 5.28E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 3.58E-13 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 1.33E-16 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 6.16E-15 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 4.85E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 1.64E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 3.67E-10 mr1815_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 1.78E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 4.14E-12 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437 NA 3.60E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251