Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421939437:

Variant ID: vg0421939437 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21939437
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAGCGGGGCCGAGCGGCAGCGTAGCGCAGGCGCTGACGGTGGCGGCGACCGGGCGGTCGGTCACGAGCGCGCGCGCGCGAGGGAACGAGCGGCATAGCC[G/A]
AAAATCGAATGGCGGCAGCGGGAAATCGGCGATGGCGGCAGCGCTGGCGTGGGAGAGAGAGATCGAACGAGAGAGAGAGACAGCGAGAGAGAGGAAGAGG

Reverse complement sequence

CCTCTTCCTCTCTCTCGCTGTCTCTCTCTCTCGTTCGATCTCTCTCTCCCACGCCAGCGCTGCCGCCATCGCCGATTTCCCGCTGCCGCCATTCGATTTT[C/T]
GGCTATGCCGCTCGTTCCCTCGCGCGCGCGCGCTCGTGACCGACCGCCCGGTCGCCGCCACCGTCAGCGCCTGCGCTACGCTGCCGCTCGGCCCCGCTGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.90%	14.50%	1.61%	0.00%	NA
All Indica	2759	95.30%	3.80%	0.87%	0.00%	NA
All Japonica	1512	74.50%	23.70%	1.79%	0.00%	NA
Aus	269	32.70%	63.20%	4.09%	0.00%	NA
Indica I	595	98.70%	0.20%	1.18%	0.00%	NA
Indica II	465	97.60%	1.90%	0.43%	0.00%	NA
Indica III	913	94.60%	5.30%	0.11%	0.00%	NA
Indica Intermediate	786	92.10%	6.10%	1.78%	0.00%	NA
Temperate Japonica	767	97.00%	2.00%	1.04%	0.00%	NA
Tropical Japonica	504	34.70%	62.50%	2.78%	0.00%	NA
Japonica Intermediate	241	85.90%	12.00%	2.07%	0.00%	NA
VI/Aromatic	96	60.40%	30.20%	9.38%	0.00%	NA
Intermediate	90	68.90%	25.60%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421939437	G -> A	LOC_Os04g35980.1	downstream_gene_variant ; 265.0bp to feature; MODIFIER	silent_mutation	Average:55.31; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N
vg0421939437	G -> A	LOC_Os04g35990.1	downstream_gene_variant ; 2762.0bp to feature; MODIFIER	silent_mutation	Average:55.31; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N
vg0421939437	G -> A	LOC_Os04g35980-LOC_Os04g35990	intergenic_region ; MODIFIER	silent_mutation	Average:55.31; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421939437	NA	3.57E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	4.79E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	8.20E-08	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	5.11E-07	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	1.75E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	1.49E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	1.67E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	7.20E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	1.62E-06	mr1415_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	5.28E-09	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	3.58E-13	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	1.33E-16	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	6.16E-15	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	4.85E-08	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	1.64E-08	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	3.67E-10	mr1815_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	1.78E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	4.14E-12	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421939437	NA	3.60E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251