\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421834990:

Variant ID: vg0421834990 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21834990
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATAATCTTGATCAAATTGACCAATAAAAATACATTTAATATAATATAAAACGGAGGGTGCAGCAGTTTTTCGGTTGGTCCTCCTGCGGTGCCGGTCGAT[C/G]
GAGACGAAAAGAGGGGGGGGGGGGGGGGGGTACGTTAGTTAGCCGTAGCTGTCTGTTCCGTCGCAACGGGCTTTGGCGAGGTAGCCACGGCGGCTACAGC

Reverse complement sequence

GCTGTAGCCGCCGTGGCTACCTCGCCAAAGCCCGTTGCGACGGAACAGACAGCTACGGCTAACTAACGTACCCCCCCCCCCCCCCCCCTCTTTTCGTCTC[G/C]
ATCGACCGGCACCGCAGGAGGACCAACCGAAAAACTGCTGCACCCTCCGTTTTATATTATATTAAATGTATTTTTATTGGTCAATTTGATCAAGATTATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 5.90% 4.10% 0.97% NA
All Indica  2759 96.60% 0.50% 2.17% 0.76% NA
All Japonica  1512 74.10% 17.30% 6.88% 1.65% NA
Aus  269 91.80% 0.40% 7.81% 0.00% NA
Indica I  595 93.60% 1.20% 5.04% 0.17% NA
Indica II  465 93.10% 0.90% 3.66% 2.37% NA
Indica III  913 98.90% 0.10% 0.33% 0.66% NA
Indica Intermediate  786 98.20% 0.10% 1.27% 0.38% NA
Temperate Japonica  767 58.00% 30.80% 9.26% 1.96% NA
Tropical Japonica  504 94.00% 1.40% 3.97% 0.60% NA
Japonica Intermediate  241 83.80% 7.90% 5.39% 2.90% NA
VI/Aromatic  96 96.90% 0.00% 3.12% 0.00% NA
Intermediate  90 88.90% 4.40% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421834990 C -> DEL N N silent_mutation Average:97.807; most accessible tissue: Zhenshan97 flower, score: 99.373 N N N N
vg0421834990 C -> G LOC_Os04g35830.1 upstream_gene_variant ; 921.0bp to feature; MODIFIER silent_mutation Average:97.807; most accessible tissue: Zhenshan97 flower, score: 99.373 N N N N
vg0421834990 C -> G LOC_Os04g35820.1 downstream_gene_variant ; 4741.0bp to feature; MODIFIER silent_mutation Average:97.807; most accessible tissue: Zhenshan97 flower, score: 99.373 N N N N
vg0421834990 C -> G LOC_Os04g35820-LOC_Os04g35830 intergenic_region ; MODIFIER silent_mutation Average:97.807; most accessible tissue: Zhenshan97 flower, score: 99.373 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0421834990 C G 0.06 0.13 0.09 0.1 0.06 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421834990 NA 1.62E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421834990 2.02E-06 2.50E-08 mr1252 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421834990 NA 5.95E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421834990 NA 1.11E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251